v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) small nuclear RNA U2 at 34AB b (Dmel_CR31854, Dmel_CR33788) secondary structure diagram

Drosophila melanogaster (fruit fly) small nuclear RNA U2 at 34AB b (Dmel_CR31854, Dmel_CR33788) URS00000C9B26_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCGCUUCUCGGCCUUAUGGCUAAGAUCAAAGUGUAGUAUCUGUUCUUAUCAGCUUAACAUCUGAUAGUUCCUCCAUUGGAGGACAACAAAUGUUAAACUGAUUUUUGGAAUCAGACGGAGUGCUAGGAGCUUGCUCCACCUCUGUCGCGGGUUGGCCCGGUAUUGCAGUACCGCCGGGAUUUCGGCCCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Drosophila erecta snRNA Dere\snRNA:U2:7
  2. Drosophila sechellia snRNA Dsec\snRNA:U2:3
  3. Drosophila simulans snRNA:U2:1
  4. Drosophila yakuba snRNA Dyak\snRNA:U2:1
 2D structure Publications