Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rickettsia philipii str. 364D 5S ribosomal RNA secondary structure diagram

Rickettsia philipii str. 364D 5S ribosomal RNA URS00000C3F68_481009

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGGUGGUUAUAGCAUGAGUGAAACACACGAUCCCAUCCCGAACUCGAAUGUGAAACCUCAUAGCGCUAAUGGUACUAUGUCAUAAGGCAUGGGAGAGUAAGUCGCUGCCAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Rickettsia africae 5S rRNA
  2. Rickettsia conorii 5S rRNA
  3. Rickettsia parkeri 5S rRNA
  4. Rickettsia parkeri str. Portsmouth 5S ribosomal RNA
  5. Rickettsia peacockii 5S rRNA
  6. Rickettsia peacockii str. Rustic 5S ribosomal RNA
  7. Rickettsia philipii 5S rRNA
  8. Rickettsia rickettsii 5S rRNA
  9. Rickettsia rickettsii str. Arizona 5S ribosomal RNA
  10. Rickettsia rickettsii str. Brazil 5S ribosomal RNA
  11. Rickettsia rickettsii str. Colombia 5S ribosomal RNA
  12. Rickettsia rickettsii str. Hauke 5S ribosomal RNA
  13. Rickettsia rickettsii str. Hino 5S ribosomal RNA
  14. Rickettsia rickettsii str. Hlp#2 5S ribosomal RNA
  15. Rickettsia rickettsii str. Morgan 5S ribosomal RNA
  16. Rickettsia rickettsii str. R 5S ribosomal RNA
  17. Rickettsia rickettsii str. 'Sheila Smith' 5S ribosomal RNA
  18. Rickettsia sibirica 5S rRNA
2D structure