Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycobacterium kansasii 732 5S ribosomal RNA secondary structure diagram

Mycobacterium kansasii 732 5S ribosomal RNA URS00000C17E6_1299327

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACGGCGGCCACAGCGACAGGGAAACGCCCGGUCCCAUCCCGAACCCGGAAGCUAAGCCUGUCAGCGCCGAUGAUACUGCCCUUCUCGGGUGGAAAAGUAGGACACCGCCGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Mycobacterium gastri 5S ribosomal RNA
  2. Mycobacterium gastri 'Wayne' 5S ribosomal RNA
  3. Mycobacterium kansasii 5S rRNA
  4. Mycobacterium kansasii 824 5S ribosomal RNA
  5. Mycobacterium kansasii ATCC 12478 5S ribosomal RNA
  6. Mycobacterium ostraviense 5S ribosomal RNA
  7. Mycobacterium simiae 5S ribosomal RNA
2D structure Publications