Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Prevotella denticola 5S rRNA secondary structure diagram

Prevotella denticola 5S rRNA URS00000BFACE_28129

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGUGGUUAUUGCGGCGGGGUCCCACCUCUUCCCAUUCCGAACAGAGAAGUUAAGCCCGCCUGCGCCGAUGGUACUGCAAUGCAAUGCGGGAGAGUAGGUGGCCGCCUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Prevotella denticola DNF00960 5S ribosomal RNA
  2. Prevotella denticola F0289 5S ribosomal RNA
  3. Prevotella fusca 5S rRNA
  4. Prevotella fusca JCM 17724 5S ribosomal RNA
  5. Prevotella multiformis 5S rRNA
  6. Prevotella multiformis DSM 16608 5S ribosomal RNA
2D structure