Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Hypericum perforatum Hyp-miR156a URS00000BABFD_65561

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGACAGAAGAUAGAGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Amborella trichopoda atr-miR156c
  2. Ananas comosus ath-miR157a
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR157c-5p
  4. Arabidopsis thaliana ath-miR157b-5p
  5. Arachis hypogaea (peanut) ahy-miR156b-5p
  6. Asparagus officinalis aof-miR156b
  7. Brassica napus (rape) bna-miR156b
  8. Brassica oleracea (wild cabbage) bol-miR157a
  9. Brassica rapa bra-miR157a
  10. Carica papaya cpa-miR156e
  11. Cucumis melo cme-miR156b
  12. Cynara cardunculus (wild artichoke) cca-miR156c
  13. Fragaria vesca subsp. vesca fve-miR156g-5p
  14. Glycine max gma-miR156l
  15. Gossypium raimondii gra-miR157b
  16. Helianthus annuus han-miR156c
  17. Linum usitatissimum lus-miR156f
  18. Malus domestica mdm-miR156ac
  19. Manihot esculenta (cassava) mes-miR156j
  20. Medicago truncatula (barrel medic) mtr-miR156h-5p
  21. Nicotiana attenuata microRNA mir-157/156-like
  22. Pachycladon fastigiatum Pfa-miR157c
  23. Populus tomentosa Pto-miR156g
  24. Populus trichocarpa ptc-miR156h
  25. Prunus persica (peach) ppe-miR156i
  26. Ricinus communis (castor bean) rco-miR156h
  27. Rosa chinensis ath-miR157a-5p
  28. Solanum lycopersicum (tomato) sly-miR156c
  29. Solanum tuberosum (potato) stu-miR156b
  30. Theobroma cacao tcc-miR156f
  31. Vigna unguiculata vun-miR156b
  32. Vitis vinifera vvi-miR156g
  33. Vriesea carinata vca-miR156b-5p