Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Marinobacter nauticus ATCC 49840 5S ribosomal RNA secondary structure diagram

Marinobacter nauticus ATCC 49840 5S ribosomal RNA URS00000B90A8_1163748

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACGACCAUAGCGGUCUGGAACCACCUGAUCCCAUCCCGAACUCAGAAGUGAAACAGACCUGCGCCGAUGGUAGUGUGGCGUUGCCCAUGUGAGAGUAGGUCAUCGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Marinobacter nauticus 5S rRNA
2D structure