v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Methanocaldococcus jannaschii DSM 2661 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1) secondary structure diagram

Methanocaldococcus jannaschii DSM 2661 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1) URS00000B8EA0_243232

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCGGGGUAGUCUAGGGGCUAGGCAGCGGACUGCAGAUCCGCCUUACGUGGGUUCAAAUCCCACCCCCGGCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Methanocaldococcus bathoardescens tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2. Methanocaldococcus fervens AG86 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3. Methanocaldococcus sp. FS406-22 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4. Methanocaldococcus lauensis tRNA-Cys
  5. Methanocaldococcus lauensis tRNA-Cys
  6. Methanocaldococcus jannaschii RNA (71-MER) from Methanocaldococcus jannaschii (PDB 2ZZN, chain D)
 2D structure Publications