Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-2a-3p URS00000B85EA_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUCACAGCCAGCUUUGAUGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-2c
  2. Anopheles gambiae aga-miR-2
  3. Apis mellifera ame-miR-2-3p
  4. Bombyx mori (domestic silkworm) bmo-miR-2a-3p
  5. Cochliomyia hominivorax mature cho-miR-2a-1-3p
  6. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-2a-1-3p
  7. Daphnia pulex dpu-miR-2
  8. Dinoponera quadriceps dqu-miR-2a-3p
  9. Drosophila ananassae dan-miR-2a
  10. Drosophila erecta der-miR-2a
  11. Drosophila grimshawi dgr-miR-2a
  12. Drosophila mojavensis dmo-miR-2a
  13. Drosophila persimilis dpe-miR-2a
  14. Drosophila pseudoobscura dps-miR-2a
  15. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294483_df_nrg
  16. Drosophila sechellia dse-miR-2a
  17. Drosophila simulans dsi-miR-2a
  18. Drosophila virilis dvi-miR-2a-3p
  19. Drosophila willistoni dwi-miR-2a
  20. Drosophila yakuba dya-miR-2a
  21. Euprymna scolopes Esc-Mir-2-o20-v2_3p (mature (guide))
  22. Heliconius melpomene (postman butterfly) hme-miR-2a
  23. Helicoverpa armigera (cotton bollworm) miR2a
  24. Hyalella azteca miR-2-1
  25. Ixodes ricinus (castor bean tick) iri-miR-2b-3p
  26. Ixodes scapularis (black-legged tick) isc-miR-2a
  27. Melibe leonina mle-miR-2b-3p
  28. Nasonia giraulti ngi-miR-2
  29. Nasonia longicornis nlo-miR-2
  30. Nasonia vitripennis nvi-miR-2c
  31. Octopus vulgaris (common octopus) Ovu-Mir-2-o23-v2_3p (mature (guide))
  32. Parasteatoda tepidariorum (common house spider) pte-miR-2d-3p
  33. Spodoptera frugiperda sfr-miR-2b-3p
  34. Tribolium castaneum (red flour beetle) tca-miR-2-3p
Publications