Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-27a (MIR27A) URS00000B6214_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Ateles geoffroyi (black-handed spider monkey) age-miR-27a
  2. Gorilla gorilla (western gorilla) ggo-miR-27a
  3. Lemur catta lca-miR-27a
  4. Macaca mulatta mml-miR-27a-3p
  5. Macaca nemestrina (pig-tailed macaque) mne-miR-27a
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8319573
  7. Ophiophagus hannah oha-miR-27a-3p
  8. Pan paniscus ppa-miR-27a
  9. Pan troglodytes ptr-miR-27a
  10. Pongo pygmaeus ppy-miR-27a
  11. Saguinus labiatus (red-chested mustached tamarin) sla-miR-27a
Publications