Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycoplasma crocodyli MP145 5S ribosomal RNA secondary structure diagram

Mycoplasma crocodyli MP145 5S ribosomal RNA URS00000B3C3B_512564

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUAGUGGUUAUAGCAAAGGGGAUCCACCUGAAUCCAUUCCGAACUCAGUAGUUAAGCCCUUUAGUGUCGACGAUAGCGGAAACGUGAAAAUAGAGAGCUGCUAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Mycoplasma crocodyli 5S rRNA
2D structure Publications