Microcebus murinus (gray mouse lemur) Mmr-Mir-582-v1_5p (mature (co-guide))

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) Mmr-Mir-582-v1_5p (mature (co-guide)) URS00000B0E50_30608

23 nucleotides
1 database (MirGeneDB)
Found in 8 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUACAGUUGUUCAACCAGUUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Bos taurus (domestic cattle) bta-miR-582
Cavia porcellus (domestic guinea pig) cpo-miR-582-5p
Dasypus novemcinctus dno-miR-582-5p
Equus caballus eca-miR-582-5p
Homo sapiens (human) hsa-miR-582-5p
Macaca mulatta (Rhesus monkey) mml-miR-582-5p
Oryctolagus cuniculus (rabbit) ocu-miR-582-5p
Pongo pygmaeus ppy-miR-582-5p

Relationships