Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ciona intestinalis cin-miR-124-3p URS00000ADB79_7719

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGCACGCGGUGAAUGCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 136 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-124-P2-v1_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-124-P3-v1_3p (mature (guide))
  3. Ascaris suum Asu-Mir-124_3p (mature (guide))
  4. Bos taurus Bta-Mir-124-P2-v1_3p (mature (guide))
  5. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-124-3p
  6. Branchiostoma floridae bfl-miR-124-3p
  7. Brugia malayi bma-miR-124
  8. Callorhinchus milii (elephant shark) Cmi-Mir-124-P2-v1_3p (mature (guide))
  9. Canis lupus familiaris (dog) Cfa-Mir-124-P2-v1_3p (mature (guide))
  10. Cavia porcellus cpo-miR-124-3p
  11. Centruroides sculpturatus Csc-Mir-124-P26_3p (mature (guide))
  12. Chrysemys picta bellii Cpi-Mir-124-P2-v1_3p (mature (guide))
  13. Ciona savignyi csa-miR-124
  14. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-124-3p
  15. Cochliomyia macellaria mature cma-miR-124-3p
  16. Columba livia (rock pigeon) cli-miR-124-3p
  17. Cricetulus griseus (Chinese hamster) cgr-miR-124
  18. Danio rerio (zebrafish) dre-miR-124-3p
  19. Daphnia magna Dma-Mir-124_3p (mature (guide))
  20. Daphnia pulex Dpu-Mir-124_3p (mature (guide))
  21. Dasypus novemcinctus dno-miR-124-3p
  22. Drosophila ananassae Dan-Mir-124_3p (mature (guide))
  23. Drosophila melanogaster (fruit fly) Dme-Mir-124_3p (mature (guide))
  24. Drosophila mojavensis Dmo-Mir-124_3p (mature (guide))
  25. Drosophila simulans Dsi-Mir-124_3p (mature (guide))
  26. Drosophila yakuba Dya-Mir-124_3p (mature (guide))
  27. Echinops telfairi Ete-Mir-124-P2-v1_3p (mature (guide))
  28. Eisenia fetida (common brandling worm) Efe-Mir-124-P15_3p (mature (guide))
  29. Eptatretus burgeri Ebu-Mir-124-P5-v1_3p (mature (guide))
  30. Gadus morhua Gmo-Mir-124-P3b-v1_3p (mature (guide))
  31. Gallus gallus (chicken) Gga-Mir-124-P2-v1_3p (mature (guide))
  32. Gekko japonicus Gja-Mir-124-P3-v1_3p (mature (guide))
  33. Haemonchus contortus (barber pole worm) hco-miR-124
  34. Heliconius melpomene hme-miR-124
  35. Homo sapiens (human) hsa-miR-124-3p
  36. Ixodes scapularis Isc-Mir-124_3p (mature (co-guide))
  37. Latimeria chalumnae (coelacanth) Lch-Mir-124-P1_3p (mature (guide))
  38. Lepisosteus oculatus Loc-Mir-124-P2-v1_3p (mature (guide))
  39. Limulus polyphemus Lpo-Mir-124-P20_3p (mature (guide))
  40. Macaca mulatta Mml-Mir-124-P2-v1_3p (mature (guide))
  41. Microcaecilia unicolor Mun-Mir-124-P2-v1_3p (mature (guide))
  42. Monodelphis domestica Mdo-Mir-124-P2-v1_3p (mature (guide))
  43. Monopterus albus Mal-Mir-124-P3b-v1_3p (mature (guide))
  44. Mus musculus (house mouse) Mmu-Mir-124-P2-v1_3p (mature (guide))
  45. Nautilus pompilius Npo-Mir-124_3p (mature (guide))
  46. Ornithorhynchus anatinus (platypus) Oan-Mir-124-P3-v1_3p (mature (guide))
  47. Oryctolagus cuniculus (rabbit) Ocu-Mir-124-P2-v1_3p (mature (guide))
  48. Paralichthys olivaceus pol-miR-124-3p
  49. Patiria miniata pmi-miR-124-3p
  50. Petromyzon marinus Pma-Mir-124-o1_3p (mature (guide))
  51. Pteropus alecto pal-miR-124-3p
  52. Ptychodera flava Pfl-Mir-124_3p (mature (guide))
  53. Python bivittatus pbv-miR-124a-3p
  54. Rattus norvegicus (Norway rat) Rno-Mir-124-P2-v1_3p (mature (guide))
  55. Saccoglossus kowalevskii sko-miR-124-3p
  56. Sarcophilus harrisii Sha-Mir-124-P2-v1_3p (mature (guide))
  57. Scyliorhinus torazame (cloudy catshark) Sto-Mir-124-P2-v1_3p (mature (guide))
  58. Sphenodon punctatus (tuatara) Spt-Mir-124-P3f_3p (mature (guide))
  59. Strongylocentrotus purpuratus Spu-Mir-124_3p (mature (guide))
  60. Taeniopygia guttata (zebra finch) Tgu-Mir-124-P2-v1_3p (mature (guide))
  61. Takifugu rubripes fru-miR-124
  62. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-124
  63. Tor tambroides miR-124-3p
  64. Tribolium castaneum Tca-Mir-124_3p (mature (guide))
  65. Triops cancriformis tcf-miR-124-3p
  66. Xenopus laevis Xla-Mir-124-P2c-v1_3p (mature (guide))
  67. Xenopus tropicalis Xtr-Mir-124-P2-v1_3p (mature (guide))
  68. Xenoturbella bocki xbo-miR-124
Publications