5S ribosomal RNA from Mycolicibacterium smegmatis MC2 155 (PDB 8V9J, chain B)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

5S ribosomal RNA from Mycolicibacterium smegmatis MC2 155 (PDB 8V9J, chain B) URS00000ACC0A_246196

118 nucleotides
2 databases (ENA, PDBe)
Found in 1 other species
18 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUUACGGCGGUCCAUAGCGGCAGGGAAACGCCCGGUCCCAUCCCGAACCCGGAAGCUAAGCCUGCCAGCGCCGAUGAUACUACCCAUCCGGGUGGAAAAGUAGGACACCGCCGAACAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Mycolicibacterium smegmatis Mycobacterium smegmatis 5S rRNA

2D structure

Publications