Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-let-7i (MIRLET7I) URS00000ABDA6_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGUUUGUGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis ami-let-7i-5p
  2. Capra hircus (goat) let-7i
  3. Cyprinus carpio (common carp) ccr-let-7i
  4. Gallus gallus gga-let-7i
  5. Gorilla gorilla ggo-let-7i
  6. Monodelphis domestica mdo-let-7i-5p
  7. Mus musculus Mus_musculus piRNA piR-mmu-72640
  8. Ovis aries miscellaneous RNA
  9. Sarcophilus harrisii sha-let-7i
  10. Xenopus laevis (African clawed frog) xla-let-7i-5p
  11. Xenopus tropicalis (tropical clawed frog) xtr-let-7i
Publications