Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-let-7i URS00000ABDA6_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGUUUGUGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Alligator mississippiensis (American alligator) ami-let-7i-5p
  2. Capra hircus let-7i
  3. Cyprinus carpio ccr-let-7i
  4. Gallus gallus (chicken) gga-let-7i
  5. Gorilla gorilla gorilla ggo-let-7i (MIRLET7I)
  6. Gorilla gorilla ggo-let-7i
  7. Monodelphis domestica mdo-let-7i-5p
  8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72640
  9. Ovis aries miscellaneous RNA
  10. Sarcophilus harrisii sha-let-7i
  11. Xenopus laevis xla-let-7i-5p
Publications