Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-515-5p URS00000A68B2_9606

Automated summary: This miRNA sequence is 24 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (miRBase, MirGeneDB, RefSeq, GeneCards, PSICQUIC, MalaCards, ENA). Described in 22 papers. Homo sapiens (human) hsa-miR-515-5p sequence is a product of miR-515-5p, miR-515, MIR515-2, RG-37, MIR515-1, hsa-RG-37, hsa-miR-515-5p, hsa-miR-515 genes. Found in the human reference genome.

Interactions 12

According to PSICQUIC, Homo sapiens (human) hsa-miR-515-5p interacts with:

Interaction id Participant Synonyms
URS00000A68B2_9606-6 O00750 O00750
URS00000A68B2_9606-0 O00750 O00750
URS00000A68B2_9606-7 P01111 P01111
URS00000A68B2_9606-1 P01111 P01111
URS00000A68B2_9606-8 P11511 P11511
URS00000A68B2_9606-2 P11511 P11511
URS00000A68B2_9606-9 Q13467 Q13467
URS00000A68B2_9606-3 Q13467 Q13467
URS00000A68B2_9606-4 Q96L34 Q96L34
URS00000A68B2_9606-10 Q96L34 Q96L34
URS00000A68B2_9606-5 Q9NP62 Q9NP62
URS00000A68B2_9606-11 Q9NP62 Q9NP62

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCUCCAAAAGAAAGCACUUUCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 3 other species

    1. Gorilla gorilla (western gorilla) ggo-miR-515-5p
    2. Pongo pygmaeus ppy-miR-515-5p