v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Alteromonadaceae bacterium 2052S.S.stab0a.01 5S ribosomal RNA secondary structure diagram

Alteromonadaceae bacterium 2052S.S.stab0a.01 5S ribosomal RNA URS00000A64CD_1304900

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUGACGACAAUAGAGCAUUGGAACCACCUGAUCCCAUCCCGAACUCAGACGUGAAACGAUGCAUCGCCGAUGGUAGUGUGGCGUUUCGCCAUGUGAGAGUAGGUCAUCGUCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Teredinibacter turnerae 5S rRNA
  2. Teredinibacter turnerae T7901 5S ribosomal RNA
 2D structure