Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Arg secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Arg URS00000A5B0D_559292

Automated summary: This tRNA sequence is 74 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 2 databases (SGD, ENA). Described in 23 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAUCUUUAAUUUAAUGGUAAAAUAUUAGAAUACGAAUCUAAUUAUAUAGGUUCAAAUCCUAUAAGAUAUUAUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 93 other species

    1. Saccharomyces cerevisiae (baker's yeast) tRNA-Arg
    2. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Arg
    3. Saccharomyces cerevisiae PE-2 tRNA-Arg
    4. Saccharomyces cerevisiae YJM1078 tRNA-Arg
    5. Saccharomyces cerevisiae YJM1083 tRNA-Arg
    6. Saccharomyces cerevisiae YJM1129 tRNA-Arg
    7. Saccharomyces cerevisiae YJM1133 tRNA-Arg
    8. Saccharomyces cerevisiae YJM1190 tRNA-Arg
    9. Saccharomyces cerevisiae YJM1199 tRNA-Arg
    10. Saccharomyces cerevisiae YJM1202 tRNA-Arg
    11. Saccharomyces cerevisiae YJM1208 tRNA-Arg
    12. Saccharomyces cerevisiae YJM1242 tRNA-Arg
    13. Saccharomyces cerevisiae YJM1244 tRNA-Arg
    14. Saccharomyces cerevisiae YJM1248 tRNA-Arg
    15. Saccharomyces cerevisiae YJM1250 tRNA-Arg
    16. Saccharomyces cerevisiae YJM1252 tRNA-Arg
    17. Saccharomyces cerevisiae YJM1273 tRNA-Arg
    18. Saccharomyces cerevisiae YJM1304 tRNA-Arg
    19. Saccharomyces cerevisiae YJM1307 tRNA-Arg
    20. Saccharomyces cerevisiae YJM1311 tRNA-Arg
    21. Saccharomyces cerevisiae YJM1326 tRNA-Arg
    22. Saccharomyces cerevisiae YJM1332 tRNA-Arg
    23. Saccharomyces cerevisiae YJM1336 tRNA-Arg
    24. Saccharomyces cerevisiae YJM1338 tRNA-Arg
    25. Saccharomyces cerevisiae YJM1341 tRNA-Arg
    26. Saccharomyces cerevisiae YJM1342 tRNA-Arg
    27. Saccharomyces cerevisiae YJM1355 tRNA-Arg
    28. Saccharomyces cerevisiae YJM1356 tRNA-Arg
    29. Saccharomyces cerevisiae YJM1381 tRNA-Arg
    30. Saccharomyces cerevisiae YJM1385 tRNA-Arg
    31. Saccharomyces cerevisiae YJM1386 tRNA-Arg
    32. Saccharomyces cerevisiae YJM1387 tRNA-Arg
    33. Saccharomyces cerevisiae YJM1388 tRNA-Arg
    34. Saccharomyces cerevisiae YJM1389 tRNA-Arg
    35. Saccharomyces cerevisiae YJM1399 tRNA-Arg
    36. Saccharomyces cerevisiae YJM1400 tRNA-Arg
    37. Saccharomyces cerevisiae YJM1401 tRNA-Arg
    38. Saccharomyces cerevisiae YJM1402 tRNA-Arg
    39. Saccharomyces cerevisiae YJM1418 tRNA-Arg
    40. Saccharomyces cerevisiae YJM1419 tRNA-Arg
    41. Saccharomyces cerevisiae YJM1433 tRNA-Arg
    42. Saccharomyces cerevisiae YJM1434 tRNA-Arg
    43. Saccharomyces cerevisiae YJM1439 tRNA-Arg
    44. Saccharomyces cerevisiae YJM1443 tRNA-Arg
    45. Saccharomyces cerevisiae YJM1444 tRNA-Arg
    46. Saccharomyces cerevisiae YJM1447 tRNA-Arg
    47. Saccharomyces cerevisiae YJM1450 tRNA-Arg
    48. Saccharomyces cerevisiae YJM1460 tRNA-Arg
    49. Saccharomyces cerevisiae YJM1463 tRNA-Arg
    50. Saccharomyces cerevisiae YJM1477 tRNA-Arg
    51. Saccharomyces cerevisiae YJM1478 tRNA-Arg
    52. Saccharomyces cerevisiae YJM1479 tRNA-Arg
    53. Saccharomyces cerevisiae YJM1526 tRNA-Arg
    54. Saccharomyces cerevisiae YJM1527 tRNA-Arg
    55. Saccharomyces cerevisiae YJM1549 tRNA-Arg
    56. Saccharomyces cerevisiae YJM1573 tRNA-Arg
    57. Saccharomyces cerevisiae YJM1574 tRNA-Arg
    58. Saccharomyces cerevisiae YJM1592 tRNA-Arg
    59. Saccharomyces cerevisiae YJM1615 tRNA-Arg
    60. Saccharomyces cerevisiae YJM189 tRNA-Arg
    61. Saccharomyces cerevisiae YJM193 tRNA-Arg
    62. Saccharomyces cerevisiae YJM195 tRNA-Arg
    63. Saccharomyces cerevisiae YJM244 tRNA-Arg
    64. Saccharomyces cerevisiae YJM248 tRNA-Arg
    65. Saccharomyces cerevisiae YJM270 tRNA-Arg
    66. Saccharomyces cerevisiae YJM271 tRNA-Arg
    67. Saccharomyces cerevisiae YJM320 tRNA-Arg
    68. Saccharomyces cerevisiae YJM326 tRNA-Arg
    69. Saccharomyces cerevisiae YJM428 tRNA-Arg
    70. Saccharomyces cerevisiae YJM451 tRNA-Arg
    71. Saccharomyces cerevisiae YJM453 tRNA-Arg
    72. Saccharomyces cerevisiae YJM456 tRNA-Arg
    73. Saccharomyces cerevisiae YJM470 tRNA-Arg
    74. Saccharomyces cerevisiae YJM541 tRNA-Arg
    75. Saccharomyces cerevisiae YJM554 tRNA-Arg
    76. Saccharomyces cerevisiae YJM555 tRNA-Arg
    77. Saccharomyces cerevisiae YJM627 tRNA-Arg
    78. Saccharomyces cerevisiae YJM681 tRNA-Arg
    79. Saccharomyces cerevisiae YJM682 tRNA-Arg
    80. Saccharomyces cerevisiae YJM683 tRNA-Arg
    81. Saccharomyces cerevisiae YJM689 tRNA-Arg
    82. Saccharomyces cerevisiae YJM693 tRNA-Arg
    83. Saccharomyces cerevisiae YJM789 tRNA-Arg
    84. Saccharomyces cerevisiae YJM969 tRNA-Arg
    85. Saccharomyces cerevisiae YJM972 tRNA-Arg
    86. Saccharomyces cerevisiae YJM975 tRNA-Arg
    87. Saccharomyces cerevisiae YJM978 tRNA-Arg
    88. Saccharomyces cerevisiae YJM981 tRNA-Arg
    89. Saccharomyces cerevisiae YJM984 tRNA-Arg
    90. Saccharomyces cerevisiae YJM987 tRNA-Arg
    91. Saccharomyces cerevisiae YJM990 tRNA-Arg
    92. Saccharomyces cerevisiae YJM993 tRNA-Arg
    93. Saccharomyces cerevisiae YJM996 tRNA-Arg
    94. Saccharomyces mikatae tRNA-Arg
    2D structure New