Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-18a URS00000A05D9_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-18a: Bta-mir-18a is a microRNA that has been found to be expressed at relatively higher levels in the ovarian cortical portion [PMC2762473]. It is also one of the known miRNAs that show consistent relative expression in the high motility (HM) and low motility (LM) fractions of sperm [PMC5209821]. In the distal jejunum, bta-mir-18a has been found to be negatively correlated with several genes, including F3, PTGS2, THEMIS, ITK, and TIFA [PMC7959717]. It is also negatively correlated with ITCH, GJA1, IL4R, F3, and CD7 in the distal jejunum and is associated with immune cell trafficking and humoral immune response [PMC7959717]. Bta-mir-18a has been shown to be negatively correlated with several transporters pathways [PMC9378797]. It also shows a strong correlation with several miRNAs such as bta-miR-96, bta-miR-652, and bta-miR-6123 [PMC9378797]. Interestingly, bta-mir-18a shows an inverse correlation pattern with microbiota composition compared to other miRNAs [PMC9378797]. In both humans and cattle studies, bta-mir-18a has been associated with bacteria such as E. coli shedding in cattle's distal jejunum [PMC9378797]. Bta-mir-18a is also correlated with methane metabolism as well as ABC transporters and transcription factors pathways [PMC9378797].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGUGCAUCUAGUGCAGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 67 other species

  1. Ateles geoffroyi age-miR-18
  2. Canis lupus familiaris (dog) cfa-miR-18a
  3. Columba livia (rock pigeon) cli-miR-18a-5p
  4. Danio rerio dre-miR-18a
  5. Gadus morhua (Atlantic cod) gmo-miR-18a-5p
  6. Gallus gallus gga-miR-18a-5p
  7. Gorilla gorilla gorilla ggo-miR-18a (MIR18A)
  8. Gorilla gorilla (western gorilla) ggo-miR-18a
  9. Haplochromis burtoni abu-miR-18a
  10. Homo sapiens (human) miscellaneous RNA
  11. Lagothrix lagotricha lla-miR-18
  12. Lemur catta lca-miR-18
  13. Macaca mulatta (Rhesus monkey) mml-miR-18a-5p
  14. Macaca nemestrina (pig-tailed macaque) mne-miR-18
  15. Maylandia zebra mze-miR-18a
  16. Monodelphis domestica mdo-miR-18a-5p
  17. Mus musculus Mus_musculus piRNA piR-mmu-72635
  18. Neolamprologus brichardi nbr-miR-18a
  19. Oreochromis niloticus (Nile tilapia) oni-miR-18a
  20. Pan paniscus (pygmy chimpanzee) ppa-miR-18
  21. Pan troglodytes (chimpanzee) ptr-miR-18a
  22. Pongo pygmaeus ppy-miR-18a
  23. Pteropus alecto (black flying fox) pal-miR-18a-5p
  24. Pundamilia nyererei pny-miR-18a
  25. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63164
  26. Saguinus labiatus sla-miR-18
  27. Salmo salar (Atlantic salmon) ssa-miR-18b-5p
  28. Sus scrofa ssc-miR-18a
  29. Taeniopygia guttata tgu-miR-18a
  30. Takifugu rubripes (torafugu) fru-miR-18
  31. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-18
  32. Tor tambroides miR-18a
  33. Xenopus laevis (African clawed frog) xla-miR-18a
  34. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3307188
Publications