v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Polynucleobacter necessarius STIR1 5S ribosomal RNA secondary structure diagram

Polynucleobacter necessarius STIR1 5S ribosomal RNA URS000009EB5D_452638

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCGGUGACCAUAGCAAGUUGGAACCACUCCUUCCCAUCCCGAACAGGACAGUGAAACGACUUUACGCCGAUGAUAGUGCGGAUUACCCGUGUGAAAGUAGGUAACUGCCGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Polynucleobacter aenigmaticus 5S ribosomal RNA
  2. Polynucleobacter duraquae 5S ribosomal RNA
  3. Polynucleobacter sp. 31A-FELB 5S ribosomal RNA
  4. Polynucleobacter sp. 32-46-5 5S ribosomal RNA
  5. Polynucleobacter sp. 5S ribosomal RNA
  6. Polynucleobacter sp. AM-25C3 5S ribosomal RNA
  7. Polynucleobacter sp. AP-Nickl1-40-C4 5S ribosomal RNA
  8. Polynucleobacter sp. AP-RePozz3-80-G7 5S ribosomal RNA
  9. Polynucleobacter sp. CS-Odin-A6 5S ribosomal RNA
  10. Polynucleobacter sphagniphilus 5S ribosomal RNA
  11. Polynucleobacter sp. JS-JIR-II-c23 5S ribosomal RNA
  12. Polynucleobacter sp. Latsch14-2 5S ribosomal RNA
  13. Polynucleobacter antarcticus 5S ribosomal RNA
  14. Polynucleobacter sp. MG-28-Ekke-A2 5S ribosomal RNA
  15. Polynucleobacter sp. MWH-Adler-W8 5S ribosomal RNA
  16. Polynucleobacter sp. MWH-Tro8-2-5-gr 5S ribosomal RNA
  17. Polynucleobacter sp. Nonnen-W13 5S ribosomal RNA
  18. Polynucleobacter sp. QLW-P1DATA-2 5S ribosomal RNA
  19. Polynucleobacter sp. Tro8-14-1 5S ribosomal RNA
  20. Polynucleobacter brandtiae 5S ribosomal RNA
  21. Polynucleobacter sp. UB-Tiil-W10 5S ribosomal RNA
 2D structure Publications