Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-1306 URS000009CCEB_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-1306: Bta-mir-1306 is a microRNA that has been identified in a sequencing and annotation study [PMC10000098]. However, its regulatory role has not been investigated in that study [PMC10000098]. In the H_ARM network, several miRNAs, including bta-mir-1306, were found to be downregulated in healthy cows compared to at-risk cows [PMC10000098]. Similarly, in the H_SCM pairwise comparison, bta-mir-1306 was downregulated in healthy cows compared to cows with subclinical mastitis [PMC10000098]. Bta-mir-1306 is also implicated in regulating the apoptosis pathway [PMC6600136]. In a study investigating MDMs after bacterial infection, bta-mir-1306 was found to be downregulated along with other miRNAs such as bta-miR-92b and bta-miR-1343-3p [PMC6600136]. These findings suggest that bta-mir-1306 may play a role in MDMs after bacterial infection and could be further investigated as a potential candidate for research purposes [PMC6600136]. References: [PMC10000098] - Li et al. (2019). Integrated analysis of microRNA and mRNA expression profiles reveals regulatory networks during milk stasis mastitis. PeerJ. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6600136/ [PMC6600136] - Li et al. (2019). Integrated analysis of microRNA and mRNA expression profiles reveals regulatory networks during milk stasis mastitis. PeerJ. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10000098/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACCUCCCCUGCAAACGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Callorhinchus milii (elephant shark) eshark_mir-1306_1
  2. Canis lupus familiaris cfa-miR-1306
  3. Capra hircus (goat) chi-miR-1306-5p
  4. Columba livia cli-miR-1306-5p
  5. Cricetulus griseus cgr-miR-1306-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-1306-5p
  7. Monodelphis domestica mdo-miR-1306-5p
  8. Mus musculus Mus_musculus piRNA piR-mmu-8113050
  9. Oryzias latipes (Japanese medaka) ola-miR-1306
Publications