Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-1306 URS000009CCEB_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACCUCCCCUGCAAACGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus (cattle) bta-miR-1306
  2. Callorhinchus milii (elephant shark) eshark_mir-1306_1
  3. Capra hircus (goat) chi-miR-1306-5p
  4. Columba livia cli-miR-1306-5p
  5. Cricetulus griseus cgr-miR-1306-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-1306-5p
  7. Monodelphis domestica mdo-miR-1306-5p
  8. Mus musculus Mus_musculus piRNA piR-mmu-8113050
  9. Oryzias latipes (Japanese medaka) ola-miR-1306
Publications