Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) aca-miR-221-3p URS000009C94C_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUUGUCUGCUGGGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Bos taurus (cattle) bta-miR-221
  2. Canis lupus familiaris cfa-miR-221
  3. Capra hircus (goat) chi-miR-221-3p
  4. Chrysemys picta (Painted turtle) cpi-miR-221-3p
  5. Columba livia (rock pigeon) cli-miR-221-3p
  6. Gadus morhua gmo-miR-221-3p
  7. Ictalurus punctatus ipu-miR-221
  8. Microcaecilia unicolor Mun-Mir-221-P2a_3p (mature (guide))
  9. Mus musculus Mus_musculus piRNA piR-mmu-72620
  10. Ornithorhynchus anatinus oan-miR-221-3p
  11. Ovis aries oar-miR-221
  12. Paralichthys olivaceus (Japanese flounder) pol-miR-221-3p
  13. Pteropus alecto (black flying fox) pal-miR-221-3p
  14. Python bivittatus (Burmese python) pbv-miR-221-3p
  15. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62979
  16. Salmo salar (Atlantic salmon) ssa-miR-221-5p
  17. Sus scrofa ssc-miR-221-3p
  18. Xenopus laevis xla-miR-221-3p
  19. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3647375
Publications