Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila virilis (Fruit fly) snRNA Dvir\snRNA:U6:1 secondary structure diagram

Drosophila virilis (Fruit fly) snRNA Dvir\snRNA:U6:1 URS000009C54D_7244

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCUUGCUUCGGCAGAACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAAUCGUGAAGCGUUCCACAUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Bactrocera dorsalis U6 spliceosomal RNA
  2. Bactrocera tryoni (Queensland fruitfly) U6 spliceosomal RNA
  3. Belgica antarctica U6 spliceosomal RNA
  4. Ceratitis capitata (Mediterranean fruit fly) U6 spliceosomal RNA
  5. Clunio marinus U6 spliceosomal RNA
  6. Drosophila ananassae snRNA Dana\snRNA:U6:1
  7. Drosophila busckii U6 spliceosomal RNA
  8. Drosophila erecta snRNA Dere\snRNA:U6:2
  9. Drosophila ficusphila U6 spliceosomal RNA
  10. Drosophila grimshawi (Fruit fly) snRNA Dgri\snRNA:U6:1
  11. Drosophila guanche non-coding RNA
  12. Drosophila melanogaster small nuclear RNA U6 at 96A a (Dmel_CR31379, Dmel_CR31539, Dmel_CR32867)
  13. Drosophila mojavensis (Fruit fly) snRNA Dmoj\snRNA:U6:1
  14. Drosophila persimilis snRNA Dper\snRNA:U6:1
  15. Drosophila pseudoobscura pseudoobscura snRNA Dpse\snRNA:U6:1
  16. Drosophila sechellia snRNA Dsec\snRNA:U6:1
  17. Drosophila simulans U6 spliceosomal RNA
  18. Drosophila willistoni snRNA Dwil\snRNA:U6:1
  19. Drosophila yakuba (Fruit fly) snRNA Dyak\snRNA:U6:1
  20. Hermetia illucens U6 spliceosomal RNA
  21. Lucilia cuprina U6 spliceosomal RNA
  22. Lutzomyia longipalpis (Sand fly) U6 spliceosomal RNA
  23. Musca domestica U6 spliceosomal RNA
  24. Phlebotomus papatasi (Sand fly) U6 spliceosomal RNA
  25. Rhagoletis pomonella (Apple magot fly) U6 spliceosomal RNA
  26. Stomoxys calcitrans U6 spliceosomal RNA
2D structure Publications