Homo sapiens (human) SPRY4 antisense RNA 1 (SPRY4-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SPRY4 antisense RNA 1 (SPRY4-AS1) URS000009C154_9606

591 nucleotides
10 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, MalaCards, NONCODE, RefSeq)
Found in 0 other species
20 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SPRY4-AS1: SPRY4-AS1 is a long non-coding RNA (lncRNA) that has been found to positively correlate with SPRY4 [PMC8521147]. In a study, several lncRNAs, including LINC02154, SPRY4-AS1, LNCSRLR, and KLHL7-DT, were identified to have high-risk characteristics [PMC7198905]. High expression of these lncRNAs was associated with shortened overall survival (OS) in patients [PMC7198905].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAUGAAUGGAGGGCGGCGGCGACUGCUGCAGCUGGGCCAGCUGCGCGGGCUGCACCCCCUCCCAGCCUGCGAGAGGAGGAAGCUAGUAGAAGAUUUGUACCAACAAAACCAAGGAGUAAACAACUUGAGAAUAACUGCAUGAGCUCAGGGCUUGGACUGUCAGAUUCCAUUUCUAAGCUUCCAGAAGAGCGACACAUAGACACUGGGGAAGUCAGAGCCUUUGAACUCCAAUGCCAUCCCCGUCACCCACCUCCACCACCAGCACCACCACCGAAUGGCACUUUGGACAAUUUUUCCCUCUCAUGUGACUUUUGUCAUUUCUUACGUCAGUUGGAGCCAGCACCUCUCAAAUCCAUCUUCUAAAACCCAGAAAAUUGUGUGUAACACAUGAUGACUGAAAGGGAGUAGGCUGACCAGUUAAGAGCCUGCCACUGGAAUGGAAGGCUGUGGGAAGGUGAGGGGACGGUGGACAUCAACCGGGAAGAGCUGAAAGAUGGCGUUACCAGAACAACUUCCAGUAAAAGAAGGCACUGAGGUUUAAGUGCUACGUGGGAGCAGUUGCCGAUUUUUGCAAUGGGAGGCUGCAUAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications