Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1909-3p URS000009A9A2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1909: One more hESC highly expressed miRNA, hsa-mir-1909, was implicated in hESC physiology by targeting Notch [PMC3275573]. It can be observed for the whole analysed group of 12 miRNAs that their overexpression is associated with increased expression of mRNA transcripts, regulated by the miRNA (except for identified decrease in the transcriptional activity of DIAPH1 with the increased expression of regulating miRNAs: hsa-miR-1275, hsa-miR-143, hsa-mir-1909, and hsa-miR-199a-5p) [PMC5816894]. The incubation of NHDF cell cultures for 2 hours with a biological drug leads to changes in the expression of 12 miRNAs (hsa-miR-1231, hsa-miR-1275, hsa-miR-143, hsa-miR-16, hsa-mir-1909, hsa-miR-196a, hsa-miR-199a-5p, hsa-miR-22, hsa-miR-3162, hsa-miR-34a, hsa-miR-382, and hsa-miR-939), regulating the expression of the analysed transcripts [PMC5816894]. The second case study is module #161, which includes seven miRNAs (hsa-mir-561, hsa-mir-1179, hsa-mir-1183, hsa-mir-1275, hsa-mir-1909, hsa-mir-552, and hsa-mir-567, as shown in Figure 4B) [PMC9618768]. Variant c.1130 G>T was predicted to be located in the target site of two miRNAs (hsa-mir-3715 and hsa-mir-1909) and the variant allele T may result in an increased MFE for these two miRNAs [PMC3444488]. The variant rs1042571 (c.1130 G>T) in the 3′ UTR was predicted to be located in the binding site of two miRNAs (hsa-mir-3715 and hsa-mir-1909) (Table 5) [PMC3444488]. Hsa-mir-1909 is expressed in the early stages of gastric cancer; however, regarding glioblastoma, there is scant information on the roles of this miRNA in the development or progression [PMC9432466].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCAGGGGCCGGGUGCUCACCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications