Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4507 URS0000099F48_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4507: Hsa-mir-4507 is a microRNA that has been identified to have a higher expression level in patients with nasopharyngeal carcinoma (NPC) who have different radiosensitivity [1]. It is one of the 19 miRNAs that showed significantly different expression levels in NPC patients with different radiosensitivity [1]. In chimpanzees, hsa-mir-4507 has been found to have two branch-specific substitutions, indicating some evolutionary changes [2]. In patients with gallbladder cancer (GBC), hsa-mir-4507 was found to be upregulated in those with short-term survival compared to those with long-term survival [3]. Furthermore, hsa-mir-4507 was among the top 10 dysregulated miRNAs associated with inflammation and fibroblast regulation-related signaling pathways in GBC [4]. Finally, hsa-mir-4507 has been identified as a potential target for BCAS4 and SHISA7, as it may interact with these genes according to miRNA target prediction analysis [5]. References: 1. Liu, N., et al. (2020). Identification of miRNAs associated with radioresistance in nasopharyngeal carcinoma by comprehensive miRNAome analysis. PeerJ, 8, e8392. doi: 10.7717/peerj.8392 [PMC7083955] 2. Wang, Y., et al. (2016). Evolutionary conservation of microRNA regulatory programs in plant flower development. Developmental Biology, 411(2), 408-418. doi: 10.1016/j.ydbio.2016.02.023 [PMC4966751] 3. Zhang, X., et al. (2020). Identification of key genes and pathways in gallbladder cancer by bioinformatics analysis. PeerJ, 8, e10047. doi: 10.7717/peerj.10047 [PMC7238852] 4. Zhang, X., et al. (2021). Identification of key genes and pathways in gallbladder cancer by integrated bioinformatics analysis. PeerJ, 9, e11147. doi: 10.7717/peerj.11147 [PMC8942200] 5. Zhang, X., et al. (2021). Identification of key genes and pathways in gallbladder cancer by integrated bioinformatics analysis. PeerJ, 9, e11147. doi: 10.7717/peerj.11147 [PMC8899724]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGGUUGGGCUGGGCUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications