Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-30c URS00000980C2_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-miR-30c: Cfa-mir-30c is a microRNA that has been studied in various contexts, including metastatic and non-metastatic mammary tumors, dogs with MMVD (myxomatous mitral valve disease), dogs with PS (pituitary-dependent hyperadrenocorticism), and heart diseases in dogs [PMC7646326] [PMC8062772] [PMC4768678] [PMC8542680] [PMC9607079]. In metastatic and non-metastatic mammary tumors, cfa-mir-30c was one of the ten microRNAs that showed significant differential expression [PMC7646326]. In dogs with MMVD, cfa-mir-30c was significantly down-regulated compared to healthy dogs [PMC8062772]. Similarly, in dogs with PS, cfa-mir-30c was significantly down-regulated compared to healthy dogs [PMC8062772]. In adrenal cortex samples, cfa-mir-30c was part of the cfa-miR-30 family and showed significant abundance along with other microRNAs such as cfa-miR-99a and cfa-miR-26 family [PMC4768678]. In a study investigating heart diseases in dogs, including cardiac hypertrophy, cfa-mir-30c was one of the 11 candidate miRNAs that were investigated using qRT-PCR [PMC8542680]. The study found that cfa-mir-30c was upregulated in the PDA (patent ductus arteriosus) group and PS group compared to healthy controls. It was also upregulated in the MMVD group compared to healthy controls. Additionally, when stage C and D heart disease cases were compared to healthy controls, cfa-mir-30c showed significant downregulation along with other microRNAs such as cfa-miR-375 and cfa-miR-19b [PMC9607079]. Overall, cfa-mir-30c has been implicated in various diseases and conditions, showing differential expression patterns.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCUCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis Ami-Mir-30-P2b_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-30-P2b_5p (mature (guide))
  3. Bos taurus Bta-Mir-30-P2d_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-30c
  5. Callorhinchus milii Cmi-Mir-30-P2b_5p (mature (guide))
  6. Cavia porcellus cpo-miR-30c-5p
  7. Cervus elaphus cel-miR-30c
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2b_5p (mature (guide))
  9. Chrysemys picta cpi-miR-30c-5p
  10. Columba livia cli-miR-30c-5p
  11. Danio rerio Dre-Mir-30-P2b_5p (mature (guide))
  12. Dasypus novemcinctus dno-miR-30c-5p
  13. Drosophila erecta Drosophila_erecta piRNA piR-der-861406
  14. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21349649
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2d_5p (mature (guide))
  16. Gadus morhua gmo-miR-30b-5p
  17. Gallus gallus gga-miR-30c-5p
  18. Gekko japonicus Gja-Mir-30-P2b_5p (mature (guide))
  19. Homo sapiens (human) Hsa-Mir-30-P2b_5p (mature (guide))
  20. Ictalurus punctatus (channel catfish) ipu-miR-30c
  21. Latimeria chalumnae Lch-Mir-30-P2b_5p (mature (guide))
  22. Lepisosteus oculatus Loc-Mir-30-P2b_5p (mature (guide))
  23. Macaca mulatta Mml-Mir-30-P2b_5p (mature (guide))
  24. Maylandia zebra mze-miR-30b
  25. Microcaecilia unicolor Mun-Mir-30-P2b_5p (mature (guide))
  26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-30-P2b_5p (mature (guide))
  27. Monopterus albus (swamp eel) Mal-Mir-30-P2d_5p (mature (guide))
  28. Mus musculus Mmu-Mir-30-P2b_5p (mature (co-guide))
  29. Neolamprologus brichardi (lyretail cichlid) nbr-miR-30b
  30. Nomascus leucogenys nle-miR-30c
  31. Ophiophagus hannah (king cobra) oha-miR-30c-5p
  32. Oreochromis niloticus oni-miR-30b
  33. Ornithorhynchus anatinus (platypus) Oan-Mir-30-P2b_5p (mature (guide))
  34. Oryctolagus cuniculus (rabbit) ocu-miR-30c-5p
  35. Pteropus alecto pal-miR-30c-5p
  36. Pundamilia nyererei pny-miR-30b
  37. Python bivittatus pbv-miR-30c-5p
  38. Rattus norvegicus (Norway rat) Rno-Mir-30-P2b_5p (mature (guide))
  39. Sarcophilus harrisii sha-miR-30c
  40. Scyliorhinus torazame Sto-Mir-30-P2d_5p (mature (guide))
  41. Sphenodon punctatus (tuatara) Spt-Mir-30-P2b_5p (mature (guide))
  42. Taeniopygia guttata (zebra finch) tgu-miR-30c-5p
  43. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-30-P2d_5p (mature (guide))
  44. Xenopus laevis Xla-Mir-30-P2b1_5p (mature (guide))
  45. Xenopus tropicalis Xtr-Mir-30-P2b_5p (mature (guide))
Publications