Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Malus domestica (apple) mdm-miR172b URS000008DEFF_3750

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAUCUUGAUGAUGCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ananas comosus microRNA 172d
  2. Arabidopsis thaliana (thale cress) AGO4_04862
  3. Citrus sinensis csi-miR172a-3p
  4. Glycine max gma-miR172f
  5. Lotus japonicus lja-miR172b
  6. Medicago truncatula mtr-miR172d-3p
  7. Sorghum bicolor (sorghum) sbi-miR172a
  8. Zea mays zma-miR172d-3p
Publications