Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae P301 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10) secondary structure diagram

Saccharomyces cerevisiae P301 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10) URS0000089FC1_1182968

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACUCCAUGGCCAAGUUGGUUAAGGCGUGCGACUGUUAAUCGCAAGAUCGUGAGUUCAACCCUCACUGGGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 136 other species

  1. Fusarium falciforme tRNA-Asn
  2. Saccharomyces arboricola H-6 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  3. Saccharomyces boulardii (nom. inval.) tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  4. Saccharomyces cerevisiae AWRI796 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  5. Saccharomyces cerevisiae tRNA
  6. Saccharomyces cerevisiae CBS 7960 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  7. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  8. Saccharomyces cerevisiae CLIB215 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  9. Saccharomyces cerevisiae CLIB324 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
  10. Saccharomyces cerevisiae CLIB382 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 4)
  11. Saccharomyces cerevisiae EC1118 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  12. Saccharomyces cerevisiae EC9-8 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  13. Saccharomyces cerevisiae FL100 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  14. Saccharomyces cerevisiae FostersB tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  15. Saccharomyces cerevisiae FostersO tRNA
  16. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  17. Saccharomyces cerevisiae Lalvin QA23 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  18. Saccharomyces cerevisiae P283 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  19. Saccharomyces cerevisiae PE-2 tRNA-Asn
  20. Saccharomyces cerevisiae PW5 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  21. Saccharomyces cerevisiae R008 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  22. Saccharomyces cerevisiae R103 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  23. Saccharomyces cerevisiae RM11-1a tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  24. Saccharomyces cerevisiae S288C tRNA-Asn
  25. Saccharomyces cerevisiae Sigma1278b tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  26. Saccharomyces cerevisiae synthetic construct tRNA-Asn
  27. Saccharomyces cerevisiae T73 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 5)
  28. Saccharomyces cerevisiae T7 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  29. Saccharomyces cerevisiae UC5 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  30. Saccharomyces cerevisiae UFMG A-905 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
  31. Saccharomyces cerevisiae Vin13 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  32. Saccharomyces cerevisiae VL3 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  33. Saccharomyces cerevisiae W303 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  34. Saccharomyces cerevisiae Y10 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
  35. Saccharomyces cerevisiae YJM1078 tRNA-Asn
  36. Saccharomyces cerevisiae YJM1083 tRNA-Asn
  37. Saccharomyces cerevisiae YJM1129 tRNA-Asn
  38. Saccharomyces cerevisiae YJM1133 tRNA-Asn
  39. Saccharomyces cerevisiae YJM1190 tRNA-Asn
  40. Saccharomyces cerevisiae YJM1199 tRNA-Asn
  41. Saccharomyces cerevisiae YJM1202 tRNA-Asn
  42. Saccharomyces cerevisiae YJM1208 tRNA-Asn
  43. Saccharomyces cerevisiae YJM1242 tRNA-Asn
  44. Saccharomyces cerevisiae YJM1244 tRNA-Asn
  45. Saccharomyces cerevisiae YJM1248 tRNA-Asn
  46. Saccharomyces cerevisiae YJM1250 tRNA-Asn
  47. Saccharomyces cerevisiae YJM1252 tRNA-Asn
  48. Saccharomyces cerevisiae YJM1273 tRNA-Asn
  49. Saccharomyces cerevisiae YJM1304 tRNA-Asn
  50. Saccharomyces cerevisiae YJM1307 tRNA-Asn
  51. Saccharomyces cerevisiae YJM1311 tRNA-Asn
  52. Saccharomyces cerevisiae YJM1326 tRNA-Asn
  53. Saccharomyces cerevisiae YJM1332 tRNA-Asn
  54. Saccharomyces cerevisiae YJM1336 tRNA-Asn
  55. Saccharomyces cerevisiae YJM1338 tRNA-Asn
  56. Saccharomyces cerevisiae YJM1341 tRNA-Asn
  57. Saccharomyces cerevisiae YJM1342 tRNA-Asn
  58. Saccharomyces cerevisiae YJM1355 tRNA-Asn
  59. Saccharomyces cerevisiae YJM1356 tRNA-Asn
  60. Saccharomyces cerevisiae YJM1381 tRNA-Asn
  61. Saccharomyces cerevisiae YJM1383 tRNA-Asn
  62. Saccharomyces cerevisiae YJM1385 tRNA-Asn
  63. Saccharomyces cerevisiae YJM1386 tRNA-Asn
  64. Saccharomyces cerevisiae YJM1387 tRNA-Asn
  65. Saccharomyces cerevisiae YJM1388 tRNA-Asn
  66. Saccharomyces cerevisiae YJM1389 tRNA-Asn
  67. Saccharomyces cerevisiae YJM1399 tRNA-Asn
  68. Saccharomyces cerevisiae YJM1400 tRNA-Asn
  69. Saccharomyces cerevisiae YJM1401 tRNA-Asn
  70. Saccharomyces cerevisiae YJM1402 tRNA-Asn
  71. Saccharomyces cerevisiae YJM1415 tRNA-Asn
  72. Saccharomyces cerevisiae YJM1417 tRNA-Asn
  73. Saccharomyces cerevisiae YJM1418 tRNA-Asn
  74. Saccharomyces cerevisiae YJM1419 tRNA-Asn
  75. Saccharomyces cerevisiae YJM1433 tRNA-Asn
  76. Saccharomyces cerevisiae YJM1434 tRNA-Asn
  77. Saccharomyces cerevisiae YJM1439 tRNA-Asn
  78. Saccharomyces cerevisiae YJM1443 tRNA-Asn
  79. Saccharomyces cerevisiae YJM1444 tRNA-Asn
  80. Saccharomyces cerevisiae YJM1447 tRNA-Asn
  81. Saccharomyces cerevisiae YJM1450 tRNA-Asn
  82. Saccharomyces cerevisiae YJM1460 tRNA-Asn
  83. Saccharomyces cerevisiae YJM1463 tRNA-Asn
  84. Saccharomyces cerevisiae YJM1477 tRNA-Asn
  85. Saccharomyces cerevisiae YJM1478 tRNA-Asn
  86. Saccharomyces cerevisiae YJM1479 tRNA-Asn
  87. Saccharomyces cerevisiae YJM1526 tRNA-Asn
  88. Saccharomyces cerevisiae YJM1527 tRNA-Asn
  89. Saccharomyces cerevisiae YJM1549 tRNA-Asn
  90. Saccharomyces cerevisiae YJM1573 tRNA-Asn
  91. Saccharomyces cerevisiae YJM1574 tRNA-Asn
  92. Saccharomyces cerevisiae YJM1592 tRNA-Asn
  93. Saccharomyces cerevisiae YJM1615 tRNA-Asn
  94. Saccharomyces cerevisiae YJM189 tRNA-Asn
  95. Saccharomyces cerevisiae YJM193 tRNA-Asn
  96. Saccharomyces cerevisiae YJM195 tRNA-Asn
  97. Saccharomyces cerevisiae YJM244 tRNA-Asn
  98. Saccharomyces cerevisiae YJM248 tRNA-Asn
  99. Saccharomyces cerevisiae YJM269 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  100. Saccharomyces cerevisiae YJM270 tRNA-Asn
  101. Saccharomyces cerevisiae YJM271 tRNA-Asn
  102. Saccharomyces cerevisiae YJM320 tRNA-Asn
  103. Saccharomyces cerevisiae YJM326 tRNA-Asn
  104. Saccharomyces cerevisiae YJM428 tRNA-Asn
  105. Saccharomyces cerevisiae YJM450 tRNA-Asn
  106. Saccharomyces cerevisiae YJM451 tRNA-Asn
  107. Saccharomyces cerevisiae YJM453 tRNA-Asn
  108. Saccharomyces cerevisiae YJM456 tRNA-Asn
  109. Saccharomyces cerevisiae YJM470 tRNA-Asn
  110. Saccharomyces cerevisiae YJM541 tRNA-Asn
  111. Saccharomyces cerevisiae YJM554 tRNA-Asn
  112. Saccharomyces cerevisiae YJM555 tRNA-Asn
  113. Saccharomyces cerevisiae YJM627 tRNA-Asn
  114. Saccharomyces cerevisiae YJM681 tRNA-Asn
  115. Saccharomyces cerevisiae YJM682 tRNA-Asn
  116. Saccharomyces cerevisiae YJM683 tRNA-Asn
  117. Saccharomyces cerevisiae YJM689 tRNA-Asn
  118. Saccharomyces cerevisiae YJM693 tRNA-Asn
  119. Saccharomyces cerevisiae YJM969 tRNA-Asn
  120. Saccharomyces cerevisiae YJM972 tRNA-Asn
  121. Saccharomyces cerevisiae YJM975 tRNA-Asn
  122. Saccharomyces cerevisiae YJM978 tRNA-Asn
  123. Saccharomyces cerevisiae YJM981 tRNA-Asn
  124. Saccharomyces cerevisiae YJM984 tRNA-Asn
  125. Saccharomyces cerevisiae YJM987 tRNA-Asn
  126. Saccharomyces cerevisiae YJM990 tRNA-Asn
  127. Saccharomyces cerevisiae YJM993 tRNA-Asn
  128. Saccharomyces cerevisiae YJM996 tRNA-Asn
  129. Saccharomyces cerevisiae YJSH1 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
  130. Saccharomyces eubayanus tRNA-Asn
  131. Saccharomyces kudriavzevii IFO 1802 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
  132. Saccharomyces kudriavzevii ZP591 tRNA-Asn
  133. Saccharomyces mikatae IFO 1815 tRNA-Asn
  134. Saccharomyces pastorianus tRNA-Asn
  135. Saccharomyces uvarum tRNA-Asn
  136. Vector YCy2508 tRNA-Asn
2D structure Publications