Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-362-5p URS0000085F64_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCCUUGGAACCUAGGUGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Callithrix jacchus Callithrix_jacchus piRNA piR-cja-1428631
  2. Canis lupus familiaris (dog) cfa-miR-362
  3. Capra hircus chi-miR-362-5p
  4. Cervus elaphus cel-miR-362-5p
  5. Dasypus novemcinctus Dno-Mir-362-P1_5p (mature (guide))
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-362-P1_5p (mature (co-guide))
  7. Equus caballus (horse) eca-miR-362-5p
  8. Homo sapiens hsa-miR-362-5p
  9. Macaca mulatta mml-miR-362-5p
  10. Mus musculus Mus_musculus piRNA piR-mmu-63603776
  11. Ovis aries oar-miR-362
  12. Pongo pygmaeus ppy-miR-362-5p
Publications