Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GPR158 antisense RNA 1 (GPR158-AS1) URS00000853F4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GPR158-AS1: GPR158-AS1 is a long non-coding RNA (lncRNA) that has been found to be closely related to the overall survival (OS) of non-small cell lung cancer (NSCLC) patients [PMC5584202]. The molecular mechanisms underlying the role of GPR158-AS1 in cancer still need to be explored [PMC9027133]. Elevated expression of GPR158-AS1 has been associated with poor patient outcomes in lung adenocarcinoma (LUAD) [PMC9027133]. A 4-lncRNA signature, including GPR158-AS1, has been identified as having prognostic value for LUAD based on The Cancer Genome Atlas (TCGA) dataset [PMC6485218]. A risk-score formula for survival prediction was constructed based on the expression levels of GPR158-AS1 and other lncRNAs [PMC5584230]. Higher expression levels of GPR158-AS1 have been associated with shorter survival in NSCLC patients [PMC5584230][PMC5093404]. Although lacking information for calculation, the influences of GPR158-AS1 on prognosis have been clearly demonstrated in a study [PMC5348393]. Additionally, lncRNA KCNK15-AS1 has shown a protective effect against non-small cell lung cancer, while lncRNA SPRY4-IT1 has also been associated with shorter survival in NSCLC patients [PMC5868398][PMC5584230][PMC5093404]. References: [PMC5584202] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5584202/ [PMC9027133] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9027133/ [PM6485218] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM6485218/ [PM5584230] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM5584230/ [PMC5093404] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5093404/ [PMC5348393] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5348393/ [PMC5868398] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5868398/

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAAGAGUAACCAGCCACCCGGGCUUGUAACUCCCGUUCUCGCACUCCAGAUAAGGCGGAGACCACUUGAAGUGGCUCUUGUCCCCGCCGAGCCCGUCCUUGCGCCGCCAGCUGUGGCCCAGGCCCCGGGGCCCCUGAUUGGGGCCGCGGCGGUGUAAGUGGGGCCUCCACUUGCGCCGGAGGCCGUGGAACCACUCGGUCUCCAGAGUGGCGUUGGCCAGGUGGGGUGCGGAGGAGGACAGGUCUUGGAGCAGGAUGCGGCUCUCCUCGCGCGUGGCCUGGAGGAAGACCUGUGGGGCCGGUGCGGACAGCGAAUCGGUGCUGAAGGUGAUGGCCGCCCGGGAGAUGCUGGGCUCGCCCUCCAGAAGGCUCCACACCAGCGCCUGGUACCAAUCCAGGUCGUCCUGCAAGUUCUGCUCCCGCGACUUAUUGCUCUGCAGCAUCACGUUGAGGAAGUUGGUGGCGUGUGUCAGUGUGUCCAGCGCCCGGUGCAAGGAGGGGUGCGCGCUGGCCAGGGCUGGCCACUUCCCCGGCAGGCCCGCCAACUCGUAGCGGCCGGAGCAGUUGGCUCGCUUCAGCUGGUGGGAGUCCCCGGUGUAGAGCACUAUUCCUAGGCCUCCAAGGUGUCUCCUCAAAGACUGGCUGACCCACUUUCCAGAUGGAGCCAACAUCAUCCUCUGUCUCAUCCAUAAAUCAUGAACAGAAGGCCCAGGAAAUGAGAAGCGGAGUCCCCACUGGGAGAGUAGCAGAGCUUCCAGCAUGAGGCCCACAACGAGAUCACAGAAGCACAGCAGAAUUCUCCAGAAAGCCAGUUGUGAUCAAUGGCAGCACAGCCUGGUCCCACAGGAAAUGUUCCUGGAUUUUAAAACACAAAUAAACAGUAAUGCAGAAAUUAGAGAAGAUGUAUCAUUUACCAAAUUUAAUCUGGCACAUUUAAUAAUACAUUAUGAUAAUUAUGGCACCUGAAAGCUAGAUAUAAAUACUCAUUCAUUUGCAAUUCAUUGGCAAUAAUAGUUAUUUCUGAGAUUCCCUCAGACCAAUGAUGGUAAAGAGAAAAGAUAAAGUUAAUGAGCUUCUCCUCUGAGAGAAGGAGGUCACAGGCCACUCUUCCGGUCGUCAUUCCCUAUAAAGGAUUAAAGGUAUGAGCUCAGGGAAGGAUGACUUCCCCCAGUACUUUCUUGAAGUUCUUUUGGAAGAAGAAAUAGUUAGAUACCCUAGAGAGUCUGAUUUUGGUGUUCAUUUAGAAGUCAAAGGCAUGAGGUCAGACCUUGGUCUCAUAAUAGAUUAGCAGCAAGAGAAAUUAUUACUGUGGGUUUUGUUUUUGUAUUUAUUUAUUUAUUUAGACAUCAAGAAACUGUGAAACUGAGCAGCCCUUCAGUAGGAGCUGGUAGGAAAGGCAGCUUGAUAUGUAAGCAAUCUAGAAAAACAGCUGUACUUUCAGUAAUUAAUAAAAUUUAGUCCAAGUAUUUGCCUAAGACUUUUGCUUUUUAGUACUCAUACUUUUUACUACUCAUUCCAAGUAAAUUAAGAAUUGAAGUCGGAAGGGCCAGAUCACAGAAUGUCUCUUAAAUAUAGGCAAAUGAUUCUAGAUUUUAUACAGUAAUUCCUUGAUCACUAAUAAGUUUGUCUCUAAUAUUGACCCAAAGGUGAGGAAAAGAGUAGUUCUCAGACAAAAAAAUGCCCAGGAAUAGGUGUCAACAUAGCCGAAUGACUUGUGAAUUAGUGAAUUCCUACAAGCCAGGACAGAGCUUUUGAAAAUUAUAAUAAAGUUAUUUUCCUCUCCAGUUUUUUGGCAUUGUAUUACAAUGUCUAGGAAGGAAGCUAGGUUUCCCCACCCUCACAUAUACUCCCUUCUAUGAAGAAGGCAGAUAUAGGACAAGGACCAGGACAGUACUGGACCAUAGCACUAAGGGGUAGGCUUUUAGGCAUUAAGAGUGCGGAAGAUAAAAUUUAAAAAUCAAUCCAUCUUAAUCAAUAAAACAUCUUACCUCUGCAUAGUAUACCUACCUGAAUUCCUUUUUUGGAAUCUUUUUCCUUAUUUAAACUUGUCAUUUGAGCAGCUGAAGUAAAAAUAUGGGCCAGGACCCUCUUCUUAGUGAGAAAAUCACUUCCUACCUUCACCCCAACAACAUCGUCACUAAAACAAAUCAAUAAAAACAGCCUCCAAUCAAAGGUCAAAGGAAACCAGAGGGAGCUAAGGGAAAAUGCACCAUUAAGUGGGCAGUUCAGCCUGGUCAUUCUAGCUCUUCCUUCUAAGAGCUUUAGUUUUAAUUCAUAAAUUAUCUCUUCCUGGUUUGGUUUGGCUUUUGUGUUUUUUUUCUUGCCAUAAAAGUGAUAAGGCAUGAAAUUCCAAGUUUAGGGUGUGAGCCUGGGGGAAAAAUUGCCAAGAAAACUAUUUGGUUGCCUUCAGGCUAGGCUUCUAAGUCUUAGGGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Expression New Publications