Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-377-3p URS000007F792_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-377: Hsa-mir-377 is a microRNA that has been identified as a potential prognostic marker in various diseases, including cancer and diabetes [PMC9891867]. It has been found to be upregulated in response to PKCĪµ activation, leading to downregulation of ADAMTS5 and a reduction in cleaved aggrecan in NP cells ECM [PMC3842981]. Hsa-mir-377 has also been implicated in tumour development, suggesting a potential role in cancer progression [PMC9891867]. Additionally, it has been identified as one of the differentially expressed miRNAs in PC3 cells [PMC6874298]. Furthermore, hsa-mir-377 has been validated as one of the miRNAs that can be predicted using training data unrelated to the original dataset [PMC1159118]. References: - [PMC9891867]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9891867/ - [PMC3842981]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3842981/ - [PMC6874298]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6874298/ - [PMC1159118]: https://pubmed.ncbi.nlm.nih.gov/1159118/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACACAAAGGCAACUUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Publications