Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-497-3p URS000007D64A_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAACCACACUGUGGUGUUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Cavia porcellus cpo-miR-497-3p
  2. Cervus elaphus cel-miR-497-3p
  3. Cricetulus griseus (Chinese hamster) cgr-miR-497-3p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-497-3p
  5. Monodelphis domestica (gray short-tailed opossum) mdo-miR-497-3p
  6. Mus musculus Mus_musculus piRNA piR-mmu-48749694
  7. Oryctolagus cuniculus ocu-miR-497-3p
Publications