Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 10 (TTTY10) URS000007C6F9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY10: TTTY10 is a testes-specific gene that has been identified as a potential prognostic biomarker for predicting recurrence in patients with papillary thyroid carcinoma (PTC) [PMC6857915] [PMC8383148]. It is one of several Y-linked genes that have been found to display low expression in samples from fertile patients and high expression in samples from infertile patients [PMC6375207]. TTTY10 has also been implicated in COVID-19, as it was found to be downregulated in male patients with the disease [PMC9150012]. Additionally, TTTY10 has been identified as a potential prognostic marker for predicting tumor recurrence in PTC and has been included in a lncRNA signature for this purpose [PMC8548639] [PMC7417634]. It is involved in various cellular processes, including cell attachment, transcription, signal conduction, growth, and differentiation through its interaction with the FoxO1 gene [PMC9259367]. TTTY10 has also been associated with fertility issues, as it is located within the AZFb region of the Y chromosome that is associated with microdeletions linked to infertility [PMC9023810]. Furthermore, TTTY10 has been found to be differentially expressed between males and females and may have implications for cardiovascular disease and colorectal cancer progression [PMC7022900] [PMC5553992]. Overall, TTTY10 appears to have diverse roles and may serve as a potential biomarker or therapeutic target in various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGCAGUGAACCUAAGCCAGGAGCUGCUUAGGCAUUAAGGCUUCUAUACCCAGAAUCGUGUGCUAAGCUUUCUCUCCAAGUCAGCACAACAAAGCAAACCAGAGCAUCGUACCAACAACCUGAAAGGUCACCUGACUCCUUCCUUCUCACUCCCAUUCUGUACUUCUGCAUACGUGGGCAGGCAAGUGAAUGGUAAGUAAGCCUGCAAACAGCCUUUCUUUGUAUAGGGAAUGACAGGCAUUUCAUCAGCAACUCCAGGAUGGCAGGCCGUUAUCCUGAAACCUAUCAGAACAGCUCCUGCUUGGCUUCCAAAAUAUCACAAUUUUGGAAAUGUACAAAGGUUAGUUUUCACAGUCCUUGAAGCCUCUUUCCACCCUGGCCAUAGCCCAUGUCAGCAGUAACCUAUGUCUUUGUUUUACAUAUCAUGUUGUUUUACUCACCUGGUGCCUCCAGUGCCCUAUAGGGUCCCUGAGCUGUCCUGAUACUCUUUCUUAGAUCCUGUCAAAACACUCACUUCAACAAAUUCUGCCCUUGGACUCUGAUGGGAGGUUCUGAUAAAGAAAAUUAUUGAAAACCGCAUUAUUUAAAUGUGGUUAUAUUUCAGCUGGACCUGGAAAUAAAGACGAAAUACUGCUUCGUGACUGUGCUUUAAGGAAUUUUUGCUUCUAGGAGAUGAUUGUGAGCCAGGCAGAGGUGAAGGAGCAGGAGCAAAUAGCCAAGGCACAGUUCACAGUGCUGGAUUUUCUUGUGGAUAUAGCUGCAUUGUUGUUCCUUCUGCCUUGUCCAACUGCUUCCUGGUAUCCCUACCCUCACCUUUUCGUUAUCUUUUCAUCUCUCUAAUCAUUGAGAAAAAGAGUACAAAAAGCCAGAUUUUGCAGUUCCCUAUUUUGUAUUCCAGGUUGAAGAGUGCUCUGGCUGUAGAGGGUCCCCACGAUCUGUCAUCUAGUAACUCACCAGAUACAUAAGAUAUUUUGCCUGCUAUGAAGCCAUUGGAGAAUCAGGUCCAGCUGUGUCCUACAGAUUUAUACCCUCACUUUGGAUGCACUGUGAAUCUUGAAACAAUUCAUUUUAUACUUAACCCUUUAAGUAUAAAGUAUAUACUUCAAGUAUAAAGUGUAAGGUUGCUUCAUUUCAUGGGCCCACCCAGGAUUUAAAGGUGUAUUCCCUGAAAGAAUUGGUUCCUUCCGGUGGGUUCCUGGCUGACUUCAAGAAUGAAGCUGCAGACACUUAUGGACUGGGAGGAGGCCCACGAGAAAAACAGGAAGAACAAGAGAAAGGCUGAGGCUCUAGUGGCUGCUUUGCAGACUUGCAGAGUCCAGGAUCCCCCAGGAACUUCCACUGAUUGCUACCUGUUACCAGUGUUAAAGCCAGGGCACUUUAAGAAGAAUUGCCCAAGCCACAAGAAAAAGCCACCUUGACCACUUUUGUGGUGAAGACCACUGGAGAUUGCACUACUGACCACCAAGACAGAGACACAAUAGCGAAUCUAGAAGUGGAAGUGUGAGAGAUACCUGCAGCUGUUAAGAUGUCUGGGAAUAGACACACAAACUCUCUCUCCCAGAUAAGCAACACAAAGCAGCACAGAGCAACAGAGACUGAAAGUCUGCCUACCUGAUCAGGGAAUAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications