Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1419 SNR190 secondary structure diagram

Saccharomyces cerevisiae YJM1419 SNR190 URS0000077671_1294369

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCCUGAUGAUAAUGGUGUCUCUUCUUUCCUCGUCCGAUUCGACCAUGACGACAAGGGAUUUUAUCUCGUUCUCUUAAUGCGAAUGAUUUUGAAAAGAUGUUGCUUCUGUGACAUUUUUUUUUAAUCAUUUGUGUUUGCAAACGGGAACUUUUCUUGCCAGUGUUAUACAACACAUGCAGAUCUGAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Saccharomyces cerevisiae Small nucleolar RNA snR190
  2. Saccharomyces cerevisiae S288C Small Nucleolar RNA
  3. Saccharomyces cerevisiae YJM1083 SNR190
  4. Saccharomyces cerevisiae YJM1190 SNR190
  5. Saccharomyces cerevisiae YJM1208 SNR190
  6. Saccharomyces cerevisiae YJM1307 SNR190
  7. Saccharomyces cerevisiae YJM1381 SNR190
  8. Saccharomyces cerevisiae YJM1388 SNR190
  9. Saccharomyces cerevisiae YJM1389 SNR190
  10. Saccharomyces cerevisiae YJM1401 SNR190
  11. Saccharomyces cerevisiae YJM1460 SNR190
  12. Saccharomyces cerevisiae YJM1549 SNR190
  13. Saccharomyces cerevisiae YJM1592 SNR190
  14. Saccharomyces cerevisiae YJM1615 SNR190
  15. Saccharomyces cerevisiae YJM193 SNR190
  16. Saccharomyces cerevisiae YJM271 SNR190
  17. Saccharomyces cerevisiae YJM428 SNR190
  18. Saccharomyces cerevisiae YJM681 SNR190
  19. Saccharomyces cerevisiae YJM693 SNR190
2D structure