Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-541-5p URS0000076E54_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-541: Hsa-mir-541 is a microRNA that has been identified as differentially expressed in various studies [PMC5950030] [PMC8321750] [PMC4278335] [PMC4662465] [PMC6061222] [PMC9252828]. It has been found that low expression of hsa-mir-541 is associated with a higher survival rate in certain conditions [PMC8321750]. Hsa-mir-541 is encoded in the chromosome 14q32 region along with other survival-associated microRNAs [PMC4278335]. It has been observed that hsa-mir-541 targets multiple components of the UPS system and has functions in E3 ligases and deubiquitinases, which may contribute to poor prognosis in certain cases [PMC4278335]. Hsa-mir-541 has also been found to have the most number of predicted target genes among RE-miRs, with 264 predicted targets identified so far [PMC4278335]. In addition, hsa-mir-541 has been implicated as a negative regulator of osteoblastic differentiation, based on one study related to bone tissues [PMC6053384]. Furthermore, hsa-mir-541 is part of ceRNA networks where it may be targeted by LINC01010 along with other microRNAs such as hsa-mir-372, hsa-mir-373, and hsa-mir-488 [PMC7271455]. Overall, these findings highlight the potential role and significance of hsa-miR-541 in various biological processes and disease conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGGAUUCUGCUGUCGGUCCCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus (cattle) Bta-Mir-541_5p (mature (guide))
  2. Callithrix jacchus Callithrix_jacchus piRNA piR-cja-1749492
  3. Dasypus novemcinctus dno-miR-541-5p
  4. Echinops telfairi Ete-Mir-541_5p (mature (guide))
  5. Gorilla gorilla gorilla ggo-miR-541 (MIR541)
  6. Gorilla gorilla (western gorilla) ggo-miR-541
  7. Macaca mulatta (Rhesus monkey) mml-miR-541-5p
  8. Oryctolagus cuniculus ocu-miR-541-5p
  9. Ovis aries (sheep) oar-miR-541-5p
Publications