Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-29a-5p URS0000076995_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-29a: Ssc-mir-29a is a microRNA that is involved in the regulation of apoptosis and has been found to be differentially expressed at different time points after infection [PMC4759598]. It is initially down-regulated at 24 hours post-infection (pi), but later up-regulated at 72 hours and 14 days pi [PMC4759598]. Ssc-mir-29a has been shown to affect the functions of Akt and FoxO proteins, potentially through the regulation of PTEN protein levels [PMC4759598]. It has also been found to target BCL2 and MCL1, which are involved in apoptosis, and its down-regulation at 24 hours pi may contribute to their up-regulation [PMC4759598]. Ssc-mir-29a is the only miRNA that was found to be differentially expressed at all three examined time points [PMC4759598]. It has also been identified as a potential regulator of genes involved in leukocyte migration and chemokine activity [PMC8851844]. Ssc-mir-29a is expressed in various pig tissues, including brain, liver, heart, muscle, colon, kidney, lung, spleen, stomach, cervix and fibroblasts [PMC3427155]. It has also been shown to be highly expressed in the anterior pituitary gland [PMC4489742]. Additionally, ssc-mir-29a expression was enhanced at D100 compared to E90 in pigs [PMC4423774]. In functional studies using FBCs (fibroblast-like cells), ssc-mir-29a mimics or inhibitors were used for transfection experiments along with negative controls or EDAR siRNA for comparison purposes [PMC9133881].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGAUUUCUUUUGGUGUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Homo sapiens (human) hsa-miR-29a-5p
  2. Mus musculus mmu-miR-29a-5p
  3. Ornithorhynchus anatinus (platypus) oan-miR-29a-1-5p
  4. Pteropus alecto (black flying fox) pal-miR-29a-5p
  5. Rattus norvegicus rno-miR-29a-5p
Publications