Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-29a-5p URS0000076995_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-29a: Mmu-mir-29a is a specific type of microRNA (miRNA) that has been identified and studied in various contexts. It has been found to be associated with liver regeneration, as its upregulation is observed in this process [PMC9198802]. Additionally, mmu-mir-29a has been shown to be involved in the activity of dendritic cells (DCs) after CpG stimulation, with an increase in its activity [PMC6963666]. It has also been studied in the context of muscle regeneration, where its mimic was electroporated into mouse muscles to determine its effects [PMC4012934]. Mmu-mir-29a is part of the miR-29 family and has been found to be upregulated with age, suggesting its importance in the myogenesis process [PMC5219731]. In various disease contexts, such as atherosclerosis and ovarian dysfunction, mmu-mir-29a expression levels have been found to be altered [PMC3641397] [PMC4499447]. Furthermore, mmu-mir-29a has been shown to play a role in hematopoietic stem cell differentiation by targeting different genes [PMC6829453]. Overall, mmu-mir-29a is a miRNA that is involved in various biological processes and disease contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGAUUUCUUUUGGUGUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Homo sapiens (human) hsa-miR-29a-5p
  2. Ornithorhynchus anatinus (platypus) oan-miR-29a-1-5p
  3. Pteropus alecto (black flying fox) pal-miR-29a-5p
  4. Rattus norvegicus rno-miR-29a-5p
  5. Sus scrofa ssc-miR-29a-5p
Publications