v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2390 (LINC02390) URS00000719BA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02390: LINC02390 is a long intergenic noncoding RNA (lncRNA) that has been identified as a highly correlated prognostic lncRNA in various studies [PMC8585518] [PMC8637177] [PMC9329438] [PMC9641048] [PMC8924059] [PMC9659888]. It has been found to be part of a risk score signature for predicting patient outcomes in lung adenocarcinoma (LUAD) [PMC8637177]. In LUAD, LINC02390 is considered a low-risk protective lncRNA, as it has a hazard ratio (HR) value of less than 1, indicating its positive effect on prognosis [PMC8637177]. Additionally, LINC02390 has been associated with immune-related mRNAs in LUAD, suggesting its potential role in immune regulation within the tumor microenvironment [PMC8637177]. Furthermore, LINC02390 has been included in various prognostic signatures for different types of cancer, such as cuproptosis-related prognostic signature and pyroptosis-related prognostic signature [PMC9641048] [PMC9659888]. These studies highlight the potential importance of LINC02390 as a prognostic biomarker and its involvement in different biological processes. However, further research is needed to fully understand the functional role and mechanisms of action of LINC02390 in cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUUCAAUGAUGAAUCAUUUAGUUUACAAGACAUAUCUUGUAUUUUCUUUAGGUAAUUGCCAAAUCAGAGUCAAAUUUAUGAAUGGGCAACCAGUUCUCUUCACCACUUCCAGCUUAUACUCCUCUGGAGUGUAUCCUGAACCAUUGGGACGGCUUUGACCCUCAGAAUCUGGAGGAAAAACACCUCAUAGCCCUACGCACAAAGGGUUGGCCAAAUUAUGAUUUACAGGAAGGACUGAGUUGGCCUCAGGAAGGAACCAUUCAUUUCAAUACCACUUGGCAGUUGGAACUUUUCUGCAGACAUGAGGACAGAUGGUCUGAGGCCACAUAUAUGCAGGCUUUCUAUAUCUUGCAAGGCAAUCGAGACCUUGGCUAACAAUGUAAGAUAGAUCUAGCCCUCCUGUUUGCCAUCUUAGGGAAGGCUGCAAGGGGCAAGCCUAGAGAAUUAAAGAUAUGAGUCCCAGAGGCACCCCCAACAGGGGAGCCAGCUCCCUCAAGCCCUGCUCCUCCAGGUCUAUCCCAACCUCCCUAUCCAGCUUCAGCCUCUCACUUGCCCCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications