Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila ficusphila tRNA secondary structure diagram

Drosophila ficusphila tRNA URS000006FAE0_30025

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCAGUGGCCUAAUGGAUAAGGCAUCGGCCUCCUAAGCCGGGGAUUGUGGGUUCGAGUCCCAUCUGGGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Aethina tumida (Small hive beetle) transfer RNA arginine (anticodon CCU)
  2. Drosophila ananassae tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  3. Drosophila busckii tRNA
  4. Drosophila erecta tRNA-Arg (CCT) (tRNA-Arg-CCT-1 1 to 3)
  5. Drosophila grimshawi tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  6. Drosophila guanche tRNA.Arg
  7. Drosophila gunungcola tRNA-OTHER
  8. Drosophila melanogaster (fruit fly) transfer RNA:Arginine-CCT 1-2 (Dmel_CR30212, Dmel_CR31631, Dmel_CR33538)
  9. Drosophila mojavensis tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  10. Drosophila persimilis tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  11. Drosophila pseudoobscura pseudoobscura tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  12. Drosophila sechellia tRNA-Arg (CCT) (tRNA-Arg-CCT-1 1 to 3)
  13. Drosophila simulans tRNA-Arg (CCT) (tRNA-Arg-CCT-1 1 to 3)
  14. Drosophila virilis tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  15. Drosophila yakuba tRNA-Arg (CCT) (tRNA-Arg-CCT-1 1 to 3)
  16. Glossina austeni tRNA tRNA-Arg
  17. Glossina fuscipes fuscipes tRNA
  18. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Arg
  19. Glossina pallidipes (Tsetse fly) tRNA tRNA-Arg
  20. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Arg
  21. Hermetia illucens tRNA-Arg
  22. Lucilia cuprina tRNA-Arg for anticodon CCU
  23. Musca domestica tRNA MDOA012903
  24. Rhagoletis pomonella tRNA-Arg
  25. Stomoxys calcitrans tRNA-Arg
2D structure Publications