Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3609 URS000006F90B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3609: Hsa-mir-3609 is a microRNA that has been reported to have inhibitory effects on tumor proliferation, migration, stemness, and tumor-intrinsic PD-L1 expression in triple-negative breast cancer (TNBC) cells [PMC9659572]. It is one of the most upregulated microRNAs in TNBC cells and maps to chromosome 7 [PMC6541642]. Hsa-mir-3609 has been found to induce a significant reduction in the levels of CDK1 protein [PMC6541642]. It contains predictive canonical binding sites on the CDK1 mRNA 3’UTR and is involved in downregulating CDK1 expression [PMC6541642]. Hsa-mir-3609 has also been identified as one of the differentially expressed miRNAs in blood samples of patients with locally advanced breast cancer compared to healthy controls [PMC9727336]. In addition, hsa-mir-3609 has been found to be dysregulated in CD4+ T cells and is abundant only in this cell type [PMC9031252]. It is also one of the hub miRNAs identified in pancreatic cancer and polycystic ovary syndrome (PCOS) studies [PMC8350636] [PMC8538251]. Furthermore, hsa-mir-3609 has been shown to be upregulated only in a good response group compared to controls in achalasia patients [PMC8313935]. Overall, hsa-mir-3609 plays a role in various biological processes and may have potential implications for cancer diagnosis and treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGAUGAGUAAUACUGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Macaca fascicularis microRNA miR-3609-3p
Publications