Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Nuclear Mitochondrial processing Endoribonuclease secondary structure diagram

Saccharomyces cerevisiae S288C Nuclear Mitochondrial processing Endoribonuclease URS000006F31F_559292

Automated summary: This RNase MRP RNA sequence is 340 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (SGD, RefSeq, ENA, IntAct, PDBe). Described in 72 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (RNase_MRP, RF00030). Saccharomyces cerevisiae S288C Nuclear Mitochondrial processing Endoribonuclease sequence is a product of NME1 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 8

According to IntAct, Saccharomyces cerevisiae S288C Nuclear Mitochondrial processing Endoribonuclease interacts with:

Interaction id Participant Synonyms
EBI-11620359 intact:EBI-10894903 EBI-10894903 rrna 27sa2
EBI-15097079 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-11361582 intact:EBI-11361608 EBI-11361608 mrp substrate
EBI-11701107 P28005 D6VPI5 EBI-13654 FUN53 P28005 POP5 RNA-processing protein POP5 RNase P/MRP 19.6 kDa subunit YAL033W pop5_yeast
EBI-2877608 P38291 D6VQG3 E9P8X7 EBI-13670 P38291 POP7 RNA-processing protein POP7 RNases P/MRP 15.8 kDa subunit RPP2 YBR1219 YBR167C pop7_yeast
EBI-11700886 P41812 D6W0W9 EBI-13621 N1285 P41812 POP1 RNA-processing protein POP1 RNases P/MRP 100.4 kDa subunit YNL221C pop1_yeast
EBI-7730622 P53218 D6VUG5 EBI-13662 P53218 POP6 RNA-processing protein POP6 RNases P/MRP 18.2 kDa subunit YGR030C pop6_yeast
EBI-11621416 Q12530 D6VYD9 EBI-29955 Q12530 RMP1 RNA-processing protein RMP1 RNase MRP 23.6 kDa subunit YLR145W rmp1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAUCCAUGACCAAAGAAUCGUCACAAAUCGAAGCUUACAAAAUGGAGUAAAAUUUUUUUUACUCAGUAAUAUGCUUUGGGUUGAAAGUCUCCCACCAAUUCGUAUGCGGAAAACGUAAUGAGAUUUAAAAAUUUUAAAUUGUUUAAAUCAACUCAUUAAGGAGGAUGCCCUUGGGUAUUCUGCUUCUUGACCUGGUACCUCUAUUGCAGGGUACUGGUGUUUUCUUCGGUACUGGAUUCCGUUUGUAUGGAAUCUAAACCAUAGUUAUGACGAUUGCUCUUUCCCGUGCUGGAUCGAGUAACCCAAUGGAGCUUACUAUUCUUGGUCCAUGGAUUCACCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA MRP
    2. Saccharomyces cerevisiae EC1118 non-coding RNA
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_NME1
    4. Saccharomyces cerevisiae P283 NME1
    5. Saccharomyces cerevisiae PE-2 NME1
    6. Saccharomyces cerevisiae YJM1083 NME1
    7. Saccharomyces cerevisiae YJM1129 NME1
    8. Saccharomyces cerevisiae YJM1133 NME1
    9. Saccharomyces cerevisiae YJM1190 NME1
    10. Saccharomyces cerevisiae YJM1199 NME1
    11. Saccharomyces cerevisiae YJM1202 NME1
    12. Saccharomyces cerevisiae YJM1208 NME1
    13. Saccharomyces cerevisiae YJM1244 NME1
    14. Saccharomyces cerevisiae YJM1252 NME1
    15. Saccharomyces cerevisiae YJM1273 NME1
    16. Saccharomyces cerevisiae YJM1304 NME1
    17. Saccharomyces cerevisiae YJM1307 NME1
    18. Saccharomyces cerevisiae YJM1326 NME1
    19. Saccharomyces cerevisiae YJM1336 NME1
    20. Saccharomyces cerevisiae YJM1338 NME1
    21. Saccharomyces cerevisiae YJM1342 NME1
    22. Saccharomyces cerevisiae YJM1383 NME1
    23. Saccharomyces cerevisiae YJM1385 NME1
    24. Saccharomyces cerevisiae YJM1387 NME1
    25. Saccharomyces cerevisiae YJM1388 NME1
    26. Saccharomyces cerevisiae YJM1389 NME1
    27. Saccharomyces cerevisiae YJM1399 NME1
    28. Saccharomyces cerevisiae YJM1400 NME1
    29. Saccharomyces cerevisiae YJM1401 NME1
    30. Saccharomyces cerevisiae YJM1402 NME1
    31. Saccharomyces cerevisiae YJM1419 NME1
    32. Saccharomyces cerevisiae YJM1433 NME1
    33. Saccharomyces cerevisiae YJM1434 NME1
    34. Saccharomyces cerevisiae YJM1443 NME1
    35. Saccharomyces cerevisiae YJM1444 NME1
    36. Saccharomyces cerevisiae YJM1460 NME1
    37. Saccharomyces cerevisiae YJM1463 NME1
    38. Saccharomyces cerevisiae YJM1479 NME1
    39. Saccharomyces cerevisiae YJM1549 NME1
    40. Saccharomyces cerevisiae YJM1573 NME1
    41. Saccharomyces cerevisiae YJM1592 NME1
    42. Saccharomyces cerevisiae YJM1615 NME1
    43. Saccharomyces cerevisiae YJM189 NME1
    44. Saccharomyces cerevisiae YJM193 NME1
    45. Saccharomyces cerevisiae YJM195 NME1
    46. Saccharomyces cerevisiae YJM244 NME1
    47. Saccharomyces cerevisiae YJM270 NME1
    48. Saccharomyces cerevisiae YJM271 NME1
    49. Saccharomyces cerevisiae YJM326 NME1
    50. Saccharomyces cerevisiae YJM428 NME1
    51. Saccharomyces cerevisiae YJM456 NME1
    52. Saccharomyces cerevisiae YJM470 NME1
    53. Saccharomyces cerevisiae YJM554 NME1
    54. Saccharomyces cerevisiae YJM555 NME1
    55. Saccharomyces cerevisiae YJM681 NME1
    2D structure New