Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-876 precursor URS000006DA05_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR876: MIR876 is a gene that encodes two MicroRNAs, miR-876-3p and miR-876-5p [PMC3210160]. A bivariate GWAS study was conducted in Chinese and US Caucasians, focusing on femoral neck bone geometry and body lean mass, which are major risk factors for musculoskeletal disease [PMC3706967]. In Chinese individuals, MIR876 was found to be associated with bone geometry and ALM (appendicular lean mass), but these associations were not replicated in Caucasians [PMC3210160]. A group of 11 contiguous SNPs located within genomic regions containing MIR876 and MIR873 were strongly associated with ALM-BR (appendicular lean mass to body ratio) in Chinese individuals [PMC3210160]. The exact mechanisms by which MIR876 and MIR873 are involved in co-regulating bone and muscle metabolism remain unclear [PMC3210160]. In a bivariate GWAS for ALM and femoral neck bone geometry, 13 SNPs located within or near HK2, UMOD, MIR876, and MIR873 showed strong associations with both traits [PMC3210160]. Two of these SNPs were located in the promoter region of the MIR876 gene [PMC3210160]. Methylation-sensitive microRNAs including miR27A, miR-193a-5p (MIR193A), and miR-876-3p (MIR876) were also identified in the study [PMC9582525]. Additionally, pGBMs (primary glioblastomas) often exhibit a recurrent deletion on chromosome 9p21.3 that includes the MIR876 gene [PMC6388501].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGUGCUGUGGAUUUCUUUGUGAAUCACCAUAUCUAAGCUAAUGUGGUGGUGGUUUACAAAGUAAUUCAUAGUGCUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Ailuropoda melanoleuca microRNA mir-876
  2. Aotus nancymaae (Ma's night monkey) microRNA 876 (ENSANAG00000012646.1)
  3. Bos taurus microRNA bta-mir-876 precursor
  4. Callithrix jacchus microRNA mir-876
  5. Camelus ferus microRNA mir-876
  6. Canis lupus familiaris microRNA cfa-mir-876 precursor
  7. Capra hircus microRNA chi-mir-876 precursor
  8. Carlito syrichta microRNA 876 (ENSTSYG00000022603.2)
  9. Cebus imitator microRNA 876 (ENSCCAG00000014744.1)
  10. Cercocebus atys (Sooty mangabey) microRNA 876 (ENSCATG00000032988.1)
  11. Cervus elaphus hippelaphus ncRNA
  12. Chinchilla lanigera (Long-tailed chinchilla) microRNA 876 (ENSCLAG00000018148.1)
  13. Chlorocebus sabaeus (African green monkey) microRNA 876 (ENSCSAG00000025364.1)
  14. Colobus angolensis palliatus miRNA (ENSCANG00000009368.1)
  15. Felis catus microRNA mir-876
  16. Gorilla gorilla gorilla microRNA 876 (ENSGGOG00000028736.2)
  17. Heterocephalus glaber microRNA mir-876
  18. Ictidomys tridecemlineatus microRNA 876 (ENSSTOG00000017853.1)
  19. Macaca mulatta microRNA mml-mir-876 precursor
  20. Macaca nemestrina microRNA 876 (ENSMNEG00000001101.1)
  21. Mandrillus leucophaeus microRNA 876 (ENSMLEG00000010885.1)
  22. Mustela putorius furo miRNA (ENSMPUG00000020687.1)
  23. Nomascus leucogenys microRNA 876 (ENSNLEG00000025259.2)
  24. Ochotona princeps microRNA 876 (ENSOPRG00000017724.1)
  25. Otolemur garnettii (small-eared galago) microRNA 876 (ENSOGAG00000021022.1)
  26. Ovis aries (sheep) miRNA (ENSOARG00000023990.1)
  27. Pan paniscus microRNA 876 (ENSPPAG00000006190.1)
  28. Panthera pardus (leopard) microRNA 876 (ENSPPRG00000014790.1)
  29. Panthera tigris altaica miRNA (ENSPTIG00000001247.1)
  30. Pan troglodytes ptr-mir-876 (ENSPTRG00000033624.2)
  31. Papio anubis (Olive baboon) microRNA mir-876
  32. Pongo abelii microRNA mir-876
  33. Pongo pygmaeus microRNA ppy-mir-876 precursor
  34. Propithecus coquereli microRNA 876 (ENSPCOG00000007765.1)
  35. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 876 (ENSRBIG00000023671.1)
  36. Rhinopithecus roxellana microRNA 876 (ENSRROG00000001894.1)
  37. Saimiri boliviensis boliviensis microRNA 876 (ENSSBOG00000036289.1)
  38. Sus scrofa microRNA mir-876
  39. Tursiops truncatus microRNA 876 (ENSTTRG00000023437.1)
  40. Vicugna pacos (alpaca) microRNA 876 (ENSVPAG00000017032.1)
Publications