v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) WNT signaling pathway activating non-coding RNA (WSPAR) URS000006CB8E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

WSPAR: WSPAR, also known as lncTCF7, is a cancer-relevant long non-coding RNA (lncRNA) that is involved in the WNT signaling pathway [PMC6801803]. It has been reported to promote aggressiveness in hepatocellular carcinoma through epithelial-mesenchymal transition [PMC7382032]. The significance of WSPAR, along with other ncRNAs such as has-miR-4425, has-miR-4536-5p, and has-miR-410-5p, in pancreatic cancer prognosis has been investigated [PMC7382032]. The biological functions and molecular mechanisms of factors like HCAR3, PPY, RFWD2, WSPAR, and Amcinonide should be further studied to facilitate translational research in pancreatic cancer [PMC7382032]. WSPAR is transcribed 200 kb upstream of TCF7 and can activate TCF7 expression and the WNT signaling pathway by recruiting SWI/SNF to the TCF7 promoter [PMC4894931]. In hepatocellular carcinoma cells, WSPAR is highly expressed and activates expression of members of the Tcf/Lef family [PMC8987526]. Experimental assays have used MYC as a positive control and WSPAR as a negative control [PMC9662857].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCAUCCUGGCUGAACUUUGGAUAAGAUCUACGUUUGGGAUUCUUCUUGGUGAUGGAUGAUGCCUAGACCAGCCCCAGACACCCUCCCAAGCCUAAGCUCCCCUCUCCUGUUCUGACAUCCCCAUCCCACCAGGAACCCAAGCUUGUGGCCAUCGUGCCAGGAGGACUUCUUCCAGGUUUUAGUAUAGCCUGAGUGACCUCUAGGAGUCCUUGGACCUGAGCUAACUCCUGUACAAUUUUGGCCGGUUGUCUGGUUAAUAAAUUAACAAUUGGUAAUGAUAACAGCUAGCCAACAUUGUUGGUUAUAUGCCAGCCACUAAGUCCUGCAGCCACAUCCAAACAUCUUCACCCCACAGGACUAGAGGAGUCACUGACCCUGACUGCUGGGCUCCUCCGAUGGUCAUGGGCAACAACCAAAUGCAAAGCUUGGUCCCUGAUGGACACCAGUCUGAAGAACCUUUUCUAUAAGAAUCUCCUCCUGCUCUAGACUGUGCGCAUCCUAACGGCAGCAGCCUGCCUGUCCUGUGCGCCACUGUGUUCCCAGAGUCCUCAGCAGGCCCUGGCCCACCUAGGUGCUCACUGAAUGAACACACAAGAGAAUGAAUGUAAGGCCAGCUGGUGGGACAGUGAGCGUCUGCCUGCACAAUGAGGCUGCCCAGGGGAGGAAGGUACCCCCUACAUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications