Drosophila sechellia (Fruit fly) snoRNA Dsec\snoRNA:GM27514

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

$Drosophila sechellia (Fruit fly) snoRNA Dsec\snoRNA:GM27514 secondary structure diagram$

Drosophila sechellia (Fruit fly) snoRNA Dsec\snoRNA:GM27514 URS000006B630_7238

77 nucleotides
2 databases (ENA, Ensembl Metazoa)
Found in 2 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGGCAAUGAUGAACACUUUAUUUAAGCCAAACAGUUAUCCCUGUCAUAAGAAUAAUUGAUGAUAAAAGUUGCUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Drosophila melanogaster (fruit fly) snoRNA:Me28S-G3277a (Dmel_CR32893)
Drosophila simulans snoRNA:GD26580

2D structure