Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-518a-5p URS0000068BEA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-527: Hsa-mir-527 is a placental microRNA that has been found to be significantly elevated in the sera of third trimester pregnant women, with levels increased by more than 600 fold [PMC2519789]. It has also been detected in HCC cell lines and tumor tissues, where its expression was found to be significantly affected by miR-527 inhibition and mimic groups [PMC8489137]. Hsa-mir-527 has been shown to be negatively regulated by hsa_circ_0001306, as indicated by experimental results [PMC8489137]. However, hsa-mir-527 could not be enriched by the circPOFUT1 probe in a study analyzing RNA enrichment [PMC9829716]. In the context of EZH2-related sub-networks, hsa-mir-527 is one of three miRNAs that interact with EZH2 and may have potential inhibitory effects on its oncogenic function [PMC9148400]. Hsa-mir-527 is also one of several miRNAs that have been found to have anti-correlated mRNA levels for certain genes in specific cancer types [PMC4175465]. It has been proposed as an exosomal biomarker for exposure of HEK293 cells to PbS-MPA [PMC4560511]. In addition, hsa-mir-527 has been identified as one of the miRNAs negatively and significantly correlated with age in a study analyzing age-related changes in miRNA expression [PMC10126023]. It was also identified as one of the hub genes and transcription factors driving GBM tumorigenicity based on enrichment analysis [PMC6180049].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCAAAGGGAAGCCCUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-1283 (MIR1283-1)
  2. Gorilla gorilla ggo-miR-1283
  3. Pan troglodytes ptr-miR-518g-5p
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-527
Publications