Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-153-3p URS0000068B85_9606

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCAUAGUCACAAAAGUGAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 55 other species

  1. Alligator mississippiensis ami-miR-153-3p
  2. Anolis carolinensis (green anole) Aca-Mir-153-P2_3p (mature (guide))
  3. Bos taurus bta-miR-153
  4. Callithrix jacchus cja-miR-153
  5. Callorhinchus milii Cmi-Mir-153-P2_3p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-153-P2_3p (mature (guide))
  7. Capitella teleta cte-miR-153
  8. Capra hircus chi-miR-153
  9. Cavia porcellus (domestic guinea pig) cpo-miR-153-3p
  10. Chrysemys picta bellii Cpi-Mir-153-P1_3p (mature (guide))
  11. Columba livia cli-miR-153a-3p
  12. Crassostrea gigas (Pacific oyster) Cgi-Mir-153_3p (mature (guide))
  13. Danio rerio (zebrafish) dre-miR-153a-3p
  14. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-153-P1_3p (mature (guide))
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-153-P1_3p (mature (guide))
  16. Eptatretus burgeri Ebu-Mir-153-P7_3p (mature (guide))
  17. Equus caballus (horse) eca-miR-153
  18. Euprymna scolopes Esc-Mir-153-P18b_3p (mature (guide))
  19. Gadus morhua Gmo-Mir-153-P1b_3p (mature (guide))
  20. Gallus gallus (chicken) Gga-Mir-153-P2_3p (mature (guide))
  21. Gekko japonicus Gja-Mir-153-P2_3p (mature (guide))
  22. Haplochromis burtoni abu-miR-153a
  23. Latimeria chalumnae Lch-Mir-153-P2_3p (mature (guide))
  24. Lepisosteus oculatus (spotted gar) Loc-Mir-153-P2_3p (mature (guide))
  25. Lingula anatina Lan-Mir-153_3p (mature (guide))
  26. Lottia gigantea lgi-miR-153
  27. Macaca mulatta Mml-Mir-153-P2_3p (mature (guide))
  28. Maylandia zebra (zebra mbuna) mze-miR-153a
  29. Melibe leonina mle-miR-153-3p
  30. Microcaecilia unicolor Mun-Mir-153-P1_3p (mature (guide))
  31. Monodelphis domestica mdo-miR-153-3p
  32. Monopterus albus Mal-Mir-153-P1b_3p (mature (guide))
  33. Mus musculus mmu-miR-153-3p
  34. Nautilus pompilius Npo-Mir-153_3p (mature (guide))
  35. Neolamprologus brichardi (lyretail cichlid) nbr-miR-153a
  36. Octopus bimaculoides Obi-Mir-153_3p (mature (guide))
  37. Octopus vulgaris Ovu-Mir-153_3p (mature (guide))
  38. Oreochromis niloticus oni-miR-153a
  39. Ornithorhynchus anatinus oan-miR-153-3p
  40. Oryctolagus cuniculus (rabbit) Ocu-Mir-153-P1_3p (mature (guide))
  41. Pan troglodytes ptr-miR-153
  42. Pongo pygmaeus (Bornean orangutan) ppy-miR-153
  43. Pundamilia nyererei pny-miR-153a
  44. Python bivittatus (Burmese python) Pbv-Mir-153-P2_3p (mature (guide))
  45. Rattus norvegicus (Norway rat) rno-miR-153-3p
  46. Salmo salar ssa-miR-153b-3p
  47. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-153-P2_3p (mature (guide))
  48. Scyliorhinus torazame (cloudy catshark) Sto-Mir-153-P2_3p (mature (guide))
  49. Sphenodon punctatus Spt-Mir-153-P2_3p (mature (guide))
  50. Taeniopygia guttata tgu-miR-153-3p
  51. Takifugu rubripes (torafugu) fru-miR-153a
  52. Tetraodon nigroviridis tni-miR-153a
  53. Tor tambroides (Thai mahseer) miR-153a-3p
  54. Xenopus laevis Xla-Mir-153-P2c_3p (mature (guide))
  55. Xenopus tropicalis Xtr-Mir-153-P2_3p (mature (guide))
Publications