v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-153-3p URS0000068B85_59729

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UUGCAUAGUCACAAAAGUGAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 55 other species

    1. Alligator mississippiensis ami-miR-153-3p
    2. Anolis carolinensis (green anole) Aca-Mir-153-P2_3p (mature (guide))
    3. Bos taurus bta-miR-153
    4. Callithrix jacchus cja-miR-153
    5. Callorhinchus milii (elephant shark) Cmi-Mir-153-P2_3p (mature (guide))
    6. Canis lupus familiaris Cfa-Mir-153-P2_3p (mature (guide))
    7. Capitella teleta cte-miR-153
    8. Capra hircus (goat) chi-miR-153
    9. Cavia porcellus cpo-miR-153-3p
    10. Chrysemys picta bellii Cpi-Mir-153-P1_3p (mature (guide))
    11. Columba livia cli-miR-153a-3p
    12. Crassostrea gigas (Pacific oyster) Cgi-Mir-153_3p (mature (guide))
    13. Danio rerio (zebrafish) dre-miR-153a-3p
    14. Dasypus novemcinctus Dno-Mir-153-P1_3p (mature (guide))
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-153-P1_3p (mature (guide))
    16. Eptatretus burgeri (inshore hagfish) Ebu-Mir-153-P7_3p (mature (guide))
    17. Equus caballus (horse) eca-miR-153
    18. Euprymna scolopes Esc-Mir-153-P18b_3p (mature (guide))
    19. Gadus morhua Gmo-Mir-153-P1b_3p (mature (guide))
    20. Gallus gallus Gga-Mir-153-P2_3p (mature (guide))
    21. Gekko japonicus Gja-Mir-153-P2_3p (mature (guide))
    22. Haplochromis burtoni abu-miR-153a
    23. Homo sapiens hsa-miR-153-3p
    24. Latimeria chalumnae Lch-Mir-153-P2_3p (mature (guide))
    25. Lepisosteus oculatus (spotted gar) Loc-Mir-153-P2_3p (mature (guide))
    26. Lingula anatina Lan-Mir-153_3p (mature (guide))
    27. Lottia gigantea (owl limpet) lgi-miR-153
    28. Macaca mulatta Mml-Mir-153-P2_3p (mature (guide))
    29. Maylandia zebra (zebra mbuna) mze-miR-153a
    30. Melibe leonina mle-miR-153-3p
    31. Microcaecilia unicolor Mun-Mir-153-P1_3p (mature (guide))
    32. Monodelphis domestica (gray short-tailed opossum) mdo-miR-153-3p
    33. Monopterus albus (swamp eel) Mal-Mir-153-P1b_3p (mature (guide))
    34. Mus musculus (house mouse) mmu-miR-153-3p
    35. Nautilus pompilius Npo-Mir-153_3p (mature (guide))
    36. Neolamprologus brichardi nbr-miR-153a
    37. Octopus bimaculoides Obi-Mir-153_3p (mature (guide))
    38. Octopus vulgaris Ovu-Mir-153_3p (mature (guide))
    39. Oreochromis niloticus (Nile tilapia) oni-miR-153a
    40. Ornithorhynchus anatinus (platypus) oan-miR-153-3p
    41. Oryctolagus cuniculus (rabbit) Ocu-Mir-153-P1_3p (mature (guide))
    42. Pan troglodytes (chimpanzee) ptr-miR-153
    43. Pongo pygmaeus (Bornean orangutan) ppy-miR-153
    44. Pundamilia nyererei pny-miR-153a
    45. Python bivittatus (Burmese python) Pbv-Mir-153-P2_3p (mature (guide))
    46. Rattus norvegicus rno-miR-153-3p
    47. Salmo salar (Atlantic salmon) ssa-miR-153b-3p
    48. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-153-P2_3p (mature (guide))
    49. Scyliorhinus torazame (cloudy catshark) Sto-Mir-153-P2_3p (mature (guide))
    50. Sphenodon punctatus (tuatara) Spt-Mir-153-P2_3p (mature (guide))
    51. Takifugu rubripes (torafugu) fru-miR-153a
    52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-153a
    53. Tor tambroides (Thai mahseer) miR-153a-3p
    54. Xenopus laevis (African clawed frog) Xla-Mir-153-P2c_3p (mature (guide))
    55. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-153-P2_3p (mature (guide))
     Publications