Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-153-3p URS0000068B85_13616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCAUAGUCACAAAAGUGAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 55 other species

  1. Alligator mississippiensis ami-miR-153-3p
  2. Anolis carolinensis Aca-Mir-153-P2_3p (mature (guide))
  3. Bos taurus (cattle) bta-miR-153
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-153
  5. Callorhinchus milii (elephant shark) Cmi-Mir-153-P2_3p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-153-P2_3p (mature (guide))
  7. Capitella teleta cte-miR-153
  8. Capra hircus (goat) chi-miR-153
  9. Cavia porcellus cpo-miR-153-3p
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-153-P1_3p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-153a-3p
  12. Crassostrea gigas (Pacific oyster) Cgi-Mir-153_3p (mature (guide))
  13. Danio rerio (zebrafish) dre-miR-153a-3p
  14. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-153-P1_3p (mature (guide))
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-153-P1_3p (mature (guide))
  16. Eptatretus burgeri Ebu-Mir-153-P7_3p (mature (guide))
  17. Equus caballus eca-miR-153
  18. Euprymna scolopes Esc-Mir-153-P18b_3p (mature (guide))
  19. Gadus morhua (Atlantic cod) Gmo-Mir-153-P1b_3p (mature (guide))
  20. Gallus gallus (chicken) Gga-Mir-153-P2_3p (mature (guide))
  21. Gekko japonicus Gja-Mir-153-P2_3p (mature (guide))
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-153a
  23. Homo sapiens (human) hsa-miR-153-3p
  24. Latimeria chalumnae Lch-Mir-153-P2_3p (mature (guide))
  25. Lepisosteus oculatus (spotted gar) Loc-Mir-153-P2_3p (mature (guide))
  26. Lingula anatina Lan-Mir-153_3p (mature (guide))
  27. Lottia gigantea lgi-miR-153
  28. Macaca mulatta (Rhesus monkey) Mml-Mir-153-P2_3p (mature (guide))
  29. Maylandia zebra (zebra mbuna) mze-miR-153a
  30. Melibe leonina mle-miR-153-3p
  31. Microcaecilia unicolor Mun-Mir-153-P1_3p (mature (guide))
  32. Monopterus albus Mal-Mir-153-P1b_3p (mature (guide))
  33. Mus musculus (house mouse) mmu-miR-153-3p
  34. Nautilus pompilius Npo-Mir-153_3p (mature (guide))
  35. Neolamprologus brichardi nbr-miR-153a
  36. Octopus bimaculoides Obi-Mir-153_3p (mature (guide))
  37. Octopus vulgaris Ovu-Mir-153_3p (mature (guide))
  38. Oreochromis niloticus (Nile tilapia) oni-miR-153a
  39. Ornithorhynchus anatinus (platypus) oan-miR-153-3p
  40. Oryctolagus cuniculus Ocu-Mir-153-P1_3p (mature (guide))
  41. Pan troglodytes (chimpanzee) ptr-miR-153
  42. Pongo pygmaeus ppy-miR-153
  43. Pundamilia nyererei pny-miR-153a
  44. Python bivittatus Pbv-Mir-153-P2_3p (mature (guide))
  45. Rattus norvegicus (Norway rat) rno-miR-153-3p
  46. Salmo salar (Atlantic salmon) ssa-miR-153b-3p
  47. Sarcophilus harrisii Sha-Mir-153-P2_3p (mature (guide))
  48. Scyliorhinus torazame (cloudy catshark) Sto-Mir-153-P2_3p (mature (guide))
  49. Sphenodon punctatus (tuatara) Spt-Mir-153-P2_3p (mature (guide))
  50. Taeniopygia guttata (zebra finch) tgu-miR-153-3p
  51. Takifugu rubripes fru-miR-153a
  52. Tetraodon nigroviridis tni-miR-153a
  53. Tor tambroides miR-153a-3p
  54. Xenopus laevis (African clawed frog) Xla-Mir-153-P2c_3p (mature (guide))
  55. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-153-P2_3p (mature (guide))
Publications